Skip to main content

Table 3 Primer sets used for qRT-PCR analysis of the selected candidate genes upon aphid feeding on wheat plants and in vitro dsRNA synthesis of 16 candidates

From: Identifying potential RNAi targets in grain aphid (Sitobion avenae F.) based on transcriptome profiling of its alimentary canal after feeding on wheat plants

Unigene no. Forward primer Reverse primer
Unigene_6994 TAATACGACTCACTATAGGG AGCTGAAAAGTGAAATGATGGTGGTC TAATACGACTCACTATAGGG TTGCCAAACTGGAAAATCG
Unigene_ 8273 TAATACGACTCACTATAGGG AGTGCGTCAGATAGTCCGGCACC TAATACGACTCACTATAGGG CACCATTCAAATCCGTTTCTTACAGC
Unigene_ 8279 TAATACGACTCACTATAGGG AGAAAGCAATGCTGTGGCAGAAAC TAATACGACTCACTATAGGG GTGGTCGTTCTTTCAGTGATGG
Unigene_11975 TAATACGACTCACTATAGGG AGCGCTGTTGGTGCTGGTGGTGATG TAATACGACTCACTATAGGG TCGTTGGACGGTTTGGTCGATGTCT
Unigene_21088 TAATACGACTCACTATAGGG AGGTTTAACGAATCGGACCATCAGGAA TAATACGACTCACTATAGGG AAAATATGATCGCCTCAAGGGGACT
Unigene_21789 TAATACGACTCACTATAGGG AGTACCGTCCGCAAATGGTTGG TAATACGACTCACTATAGGG TCCGAAGTCACATGTTCGCA
Unigene_23028 TAATACGACTCACTATAGGG AGGTTATTGTTGAACCCTTCTGACACG TAATACGACTCACTATAGGG GAAGGATTAGACGATATTTTGGTG
Unigene_23042 TAATACGACTCACTATAGGG AGGTTCCATGACAAGCCGGATAC TAATACGACTCACTATAGGG GACTCAAGTGCCTGGTGGGT
Unigene_23235 TAATACGACTCACTATAGGG AGGGTGCCCGACTCGGTTTTCTCC TAATACGACTCACTATAGGG GCTGCCCAAGCCAACATCCAC
Unigene_26956 TAATACGACTCACTATAGGG AGCCGTGATTCTCCTGCGTCTGCT TAATACGACTCACTATAGGG AGTCTTCGCCACCGCCGTTT
Unigene_27357 TAATACGACTCACTATAGGG AGATGGTTTTATGGTTGGCTTTAGTCCAG TAATACGACTCACTATAGGG CCGCGTTCGCATTTCGTTTT
Unigene_27882 TAATACGACTCACTATAGGG AGAGGTATCACCCGCCGTACC TAATACGACTCACTATAGGG GAACAGCTGGTTCTGCGAAA
Unigene_28447 TAATACGACTCACTATAGGG AGTGGCCCGTACGACACACCGA TAATACGACTCACTATAGGG CGGACGATGTGCCGGGTGAC
Unigene_28469 TAATACGACTCACTATAGGG AGCAAATGAAACGCCGTATTTGATAA TAATACGACTCACTATAGGG CGTGCCTACCGTATTCGACAAT
Unigene_28555 TAATACGACTCACTATAGGG AGGGGTTAGACTTGCCCGAAACTGATG TAATACGACTCACTATAGGG TCCATGTTGGCAGTCCAACCGT
Unigene_29698 TAATACGACTCACTATAGGG AGCGTCGCCTTGGTGAGCCTTTAC TAATACGACTCACTATAGGG CGGCGGACGGGTGAGTAATG
Actin CCGAAAAGCTGTCATAATGAAGACC GGTGAAACCTTGTCTACTGTTACATCTTG
GFP TAATACGACTCACTATAGGG AGGCAGTGCTTCAGCCGCTACCC TAATACGACTCACTATAGGG CCTTGATGCCGTTCTTCTGCTTGTC
  1. Note: T7 promoter sequences were tailed to each 5’ end of primers and underlined. The sequences without T7 promoter sequence tails were used for qRT-PCR analysis of the selected candidate genes upon aphid feeding on wheat plants.