Skip to main content

Table 4 PCR primer pairs

From: Analysis of Phakopsora pachyrhizi transcript abundance in critical pathways at four time-points during infection of a susceptible soybean cultivar using deep sequencing

Name Encoded protein Sequence Size (bp)
NADHf-7 NADH dehydrogenase subunit f Forward: TCCCAGACACGATTAGTTACAAATGCT 107
Reverse: TGGGAATTGGTTGGAATGTG
60SRPL18-10 60S ribosomal protein L18 Forward: GCCCTCAGACACCCTACCG 168
Reverse: ACCTCGCGATGCTCTTCTTC
RBCOlu-0 ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit Forward: CGGTATTTATTTCACTCAGGATTGGGT 104
Reverse: CAAAGATCTCGGTCAGAGCAGGC
PME-7 Pectin methylesterase Forward: CTCGTGGATGGTTGGAGTGGA 105
Reverse: CATTGAACCCGTTGGCCCAC
Mat-48 Maturase-related protein Forward: ACCAATTTACGATGTCTCCGTCGC 135
Reverse:CTATACAGATAGAGGCGCCTATCAAAAAG
SPT-10 Serine palmitoyltransferase Forward:GAGGAGTATGCGATTACTATGGAGTTG 68
Reverse: CTTTGTCAGAGTTCCCATCAAGAT
αTUB Alpha-tubulin Forward: CCAAGGCTTCTTCGTGTTTCA 65
   Reverse: CAAGAGAAGAGCGCCAAACC