Skip to main content

Table 1 Molecularly identified GBT-B1 gene trap lines

From: Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

  Linked trap integration Zv9 integration IMG IMG-linker-^Gal4-VP16
tpl3   19:30.5 Mb nudC YRWTQSLSEVDFSRNSPGYQK
tpl4 CTGg tcagtctttgaagaggatcaggcgttcagacagacggggggcagaatctgttacagaag 3:16936744 stat5.1 GTLSAHFRNMDFSRNSPGYQK
tpl5 CTGtttctcgccatcaccatgtgcaccagtctgttgttcgtgtataacgtcagctacaataat 2:9043594 st6GalNAc5 QGYSSIIEHKDFSRNSPGYQK
tpl6 CTGcttactagtactggaatggacccgcttatgccttcagaactgccttaatccttcgtgaca 3:34884583 nsfa MATRDFSRNSPGYQK
tpl7 CTGagtgactataaatgcctgaaaaatcaactcatgtaagcacaaaatccttttgaacttttg 21:24267477 jam3b not in frame
tpl8 CTGcagctggatcagtttgtgttgtggaatgttgaggcaggctttctttctaggattaaatgc 17:37963171 zfp36l1a FDFSEMINNKDFSRNSPGYQK
tpl9   12:30.4 Mb nfe2l1 QDIMSIMELQDFSRNSPGYQK
tpl10 CTGgggtgtctgctgattcaccaagctccaaaatattgaattcctttcgtcattaaatggcct 19:7006530 atp1a3a MEDFSRNSPGYQK
tpl11 CTGtgaggctgtgtgaattttagcctcagtttcctgttctttgctgacagaagtggcacctgg 14:49326467 bbs7 CFGMKKGEAVDFSRNSPGYQK
tpl12 CTGtttaattggtgttttttatttaatagattataacagttcgggtctgacattctcatgctg 6:30448559 sgip1 GNIALSPSPLDFSRNSPGYQK
tpl13 CTGggcacatttaatgtgtctgagtcaatgccgagtgaggcaagtcaaggtcagcgaagtgat 1:45249862 dkey-9i23.6 MEEQTAKDFSRNSPGYQK
tpl14 CTGaaaattcaacaagatatgtttgattctcaatttgaagtctctgacttttgattgcagtct 16:42014825 osbpl10 SSSSVSWAVCDFSRNSPGYQK
tpl15   19:45.3 Mb eef1a1l1 PMEAANFTSQDFSRNSPGYQK
tpl16 CTGgatagaacagggtttttccccccccccacaaaccataatcgcagacaattccaacccaaa 12:44187402 ebf3 GNPRDMRRFQDFSRNSPGYQK
tpl17 CTGttagtgtatatacagtgctcggcataactggctacaacccattttgaaaatgaatatttt 16:6676846 plecb1 LLEVLSGETLDFSRNSPGYQK
tpl18 CTGggcatatcgtacaggtaaagttacaggacccatatataaaatgaaaatcagttttaaaaa 19:14006402 fam46bb Into exon 1
tpl19 CTGacaagctaacaggctaaccttaatttagttaacgtttcatcttctctcatctgctgtttg 3:28982811 fleer GEYTATVYKMDFSRNSPGYQK
tpl20 CTGtggtcaacccctcaaacaaccgccaaccccactcaccccctaggaggagaataaaaacta 3:15727276 lasp1 PTEKVNCLDKDFSRNSPGYQK
tpl21 CTGcctgagagcaagtcaagcagtctccatattgatgaggcagagaagagctgtttgactctc 19:34858311 triqk EAKRSAPGIRDFSRNSPGYQK
tpl22 CTGacatgaccagcaatttactgcagctgccattggttgtgaaaagaattagtggcatgtgcg 12:18869291 baiap2l1a SSKYEIKENEDFSRNSPGYQK
tpl23 CTGagggattcatatttgttacatttgtaaaggcgattagttgtctttaaaaagtgagtaaaa 21:6304212 fnbp1 TLWPFIKKNKDFSRNSPGYQK
tpl24 CTGgctgtagagatattaataaatatgttcaacttacttttcttttcctcttgtgcagatctc 17:19362393 cyp26c1 VGETFHWLFQDFSRNSPGYQK
tpl25 CTGagtaattaaactttgtccattgatttaataaaaaagctaattttaatactaagcaggggt 6:21614143 srp68 VDAKTKLEAQDFSRNSPGYQK
tpl26 CTGcacatacaataatatgctatttagatttgatacgtttttgttaaatagtaatattgttaa 20:4058970 fam89A AALALLRKEMDFSRNSPGYQK
tpl27 CTGctggggcgatagatagactttccagttagcactatctaatgcgatcccgtgaacagcatt 17:12186310 snap25b TRRMLQLVEEDFSRNSPGYQK
  1. First column, gene trap line. Second column, genomic sequence adjacent to 3’ end of the gene trap integration. The capital CTG are the last three nucleotides of Tol2. Third column, location of the gene trap integration on Zv9 zebrafish genome assembly. Fourth column, insertionally mutated gene. Fifth column, sequence of the IMG-Gal4-VP16 fusion protein, IMG sequence is highlighted in aqua, Gal4 sequence is highlighted in magenta. The “linker” sequence is encoded by the linker between splice acceptor and Gal4 in GBT-B1.