Skip to main content

Table 5 Predicted novel miRNA in Musa A- and Musa B-genomes

From: “A draft Musa balbisiana genome sequence for molecular genetics in polyploid, inter- and intra-specific Musa hybrids”

miRNA family Locus A-genome Locus B = genome Mature_miRNA sequence 5′ – 3′
mba-miR1   chr11: 8494985..8495047 AGAAACUUUUGUUGGAGAGGAAC
mac-miR2 mba-miR2 chr5:6134793..6134884 chr5: 5463327..5463417 CCGCAGGAGAGAUGAUGCCGCU
mba-miR3   chrUn_random:810706..810748 UACCGUACUGUACCGGCGUUU
mba-miR4   chr10: 20915746..20915798 CCUGAUUUGCUAAGUAGAUUU
mba-miR5   chr7: 16539311..16539413 UGGUUGAUGACGAUGUCGGCC
mac-miR6 mba-miR6 chr7:1377251..1377323 chr7: 1254647..1254718 UAGGAGAGAUGACACCGGCU
mac-miR7 mba-miR7 chr1:10560884..10561005 chr1: 9229340..9229458 AAACUAGUGCUAAGACCCAAUCUC
mba-miR8   chr1: 10667301..10667378 GGUGGUCUGGAUGAGGAUGCC
mac-miR9 mba-miR9 chr7:4569849..4569909 chr7: 4219274..4219333 UGGCUGAUGAUGAGUGAUCUU
mba-miR10   chr8: 20785187..20785267 CUUUGGCUUCUGGGUAGACGUA
mba-miR11   chr9: 8635028..8635089 UGUACGGAUAUGGUAGAGGGGCGU
mba-miR12   chr4: 17987962..17988016 AUCCCCGAGUGGGGUCGGUCGGAC
mba-miR13   chr8: 23338135..23338275 CUCGAGAUAUAUGAGUGUGGACA
mba-miR14   chrUn_random: 21488242..21488315 GGCACCUCGAUGUCGGCUC
mba-miR15   chr9: 25179371…25179434 GAGGAGGAGAAGAAAUGGAUCUG
mba-miR16   chr6: 3503608..3503675 GAAGAGGAAGGAGAAGUCG
mba-miR17   chr1: 17563902..17563986 CAGAAGUAGAAUACAUAAC
mba-miR18   chrUn_random: 135937842..135937988 UCCUUUUAGACCGUUGACGA
mac-miR19 chr4:22573796..22573893   UCCAGGAGAGAUGACACCAAC
mac-miR20 chr1:4998969..4999025   GGCGAUGAUGAUUGGUGAAUGU
mac-miR21 chrUn_random:15968301..15968390   GGAGAGAUGGCUGAGUGGACUAAA
mac-miR22 chrUn_random:23270434..23270480   CGAGGUGUAGCGCAGUCUGG
mac-miR23 chr8:31825102..31825180   UGGGAAGAAGACAAGGACAACAUG
mac-miR24 chr6:8249043..8249103   GAUCUCUGACCGAGCGGACUCC
mac-miR25 chr4:345377..345475   CAACGAUGAUGAGCCUACUAGACC
mac-miR26 chr11:15733314..15733359   AGAUGAGGUAAAGUAGUGCGA
mac-miR27 chr6:9168756..9168839   CAGCGACCUAAGGAUAACU
mac-miR28 chr7:28606179..28606234   GCGGAUGUGGCCAAGUGGU