Skip to main content

Table 2 MiRNAs, which expression have been evaluated by the northern blot hybridization method

From: High-throughput sequencing identification of novel and conserved miRNAs in the Brassica oleracea leaves

Lp. miRNA name Sequence Sequence length Number of reads
1 bol-miR9408 GTTTCATCTTAGAGAATGTTGTC 23 58
2 bol-miR9409 TTTTGTTCATGACTGCATTTTC 22 218
3 bol-miR9410 TACTTAATTATAAGTCGTCTGG 22 1681
4 bol-miR9411 TACTGGACGACTTACACGGAAG 22 420
5 bol-miR172a AGAAUCUUGAUGAUGCUGCAU 21 67605
6 bol-miR157a UUGACAGAAGAUAGAGAGCAC 21 170940
7 bna-miR166a UCGGACCAGGCUUCAUUCCCC 21 495299
8 bra-miR167a UGAAGCUGCCAGCAUGAUCUA 21 684250
9 bol-miR168c UCGCUUGGUGCAGGUCGGGAA 21 128281
10 bol-miR169k* GGCAAGUUGUCCUUCGGCUACA 22 78
11 bol-miR1885 CAUCAAUGAAAGGUAUGAUUCC 22 43
12 bol-miR403 UUAGAUUCACGCACAAACUCG 21 2170
13 bol-miR397a UCAUUGAGUGCAGCGUUGAUGU 22 1628