Skip to main content

Table 2 Sequencing primers

From: A high-throughput Sanger strategy for human mitochondrial genome sequencing

Amplicon number Primer name Sequence Source
1 F402 ATCTTTTGGCGGTATGCACTTT New
F619 TTAGACGGGCTCACATCACC [19]
R878 CCAACCCTGGGGTTAGTATAGC New
F900 CGGTCACACGATTAACCCAAG New
F1135 CCAGAACACTACGAGCCACA New
R1136 GGCGAGCAGTTTTGTTGATT New
F1320 GACGTTAGGTCAAGGTGTAGCC New
R1365 TAGCCCATTTCTTGCCACCT New
F1657 CTTGACCGCTCTGAGCTAAAC [16, 17]
R1769 GCCAGGTTTCAATTTCTATCG [16, 17]
R1924 AGGTAGCTCGTCTGGTTTCG New
F1983 TAGAGGCGACAAACCTACCG New
F2105 GAGGAACAGCTCTTTGGACAC [16, 17]
R2216 TGTTGAGCTTGAACGCTTTCTT New
F2333 GCATAAGCCTGCGTCAGAT New
R2439 ATGCCTGTGTTGGGTTGAC New
F2506 AACATCACCTCTAGCATCACCA New
R2818 GCCCCAACCGAAATTTTTAAT New
2 F2625 CTGTATGAATGGCTCCACGAG New
F2932 GGGATAACAGCGCAATCCTAT New
R3006 ATGTCCTGATCCAACATCGAG [16, 17]
F3241 AGAGCCCGGTAATCGCATAA New
R3417 GGGGCCTTTGCGTAGTTGTA New
F3441 ACTACAACCCTTCGCTGACG [16, 17]
R3632 GAGGTGGCTAGAATAAATAGGAGGC New
F3635 GCCTAGCCGTTTACTCAATCC [16, 17]
R3825 TCAGAGGTGTTCTTGTGTTGTGAT New
F3890 GAACCCCCTTCGACCTTG New
R4162 TGAGTTGGTCGTAGCGGAATC [16, 17]
F4142 GATTCCGCTACGACCAACT New
F4392 CCCATCCTAAAGTAAGGTCAGC [16, 17]
R4479 GGGGATTAATTAGTACGGGAAGG New
R4676 GATTATGGATGCGGTTGCTT New
R4811 TCAGAAGTGAAAGGGGGCTAT New
3 F4609 AAATAAACCCTCGTTCCACAGA New
F4925 CCTTCTCCTCACTCTCTCAATC New
R5034 ATCCTATGTGGGTAATTGAGGA New
F5150 CCTACTACTATCTCGCACCTGAA New
R5210 GGTGGATGGAATTAAGGGTGT New
F5318 CACCATCACCCTCCTTAACC [16, 17]
R5325 TGATGGTGGCTATGATGGTG New
R5681 GTGGGTTTAAGTCCCATTGGT New
F5664 AATGGGACTTAAACCCACAAA New
F5858 TTTACAGTCCAATGCTTCACTC New
R5799 TGCAAATTCGAAGAAGCAG New
R5994 TGCCTAGGACTCCAGCTCAT [19]
F6032 GCCAGGCAACCTTCTAGGTA New
F6318 CCTGGAGCCTCCGTAGACCT New
R6444 TTTGGTATTGGGTTATGGCAG New
F6496 CTCTCCCAGTCCTAGCTGCTG New
R6899 CATATTGCTTCCGTGGAGTGTG New
4 F6636 ATTCTTATCCTACCAGGCTTCG New
F7075 GTATGGGGATAAGGGGTGTA [16, 17]
R7248 TGGTGTATGCATCGGGGTAGT New
F7366 CCTCCATAAACCTGGAGTGA New
R7489 TGGCTTGAAACCAGCTTTG [19]
F7527 GAAAAACCATTTCATAACTTTGTCA New
R7766 TTTCCTGAGCGTCTGAGATGT New
F7821 CATCCCTACGCATCCTTTACAT New
F8129 ACCACTTTCACCGCTACACG New
R8141 CGGTGAAAGTGGTTTGGTTTA New
F8355 TTTACAGTGAAATGCCCCAAC New
R8378 TTAGTTGGGGCATTTCACTGT New
R8640 GATGAGATATTTGGAGGTGGG New
F8668 TGACTAATCAAACTAACCTCAAAACA New
F8717 AAGGACGAACCTGATCTCTTATACT New
R8949 TAGTATGGGGATAAGGGGTGTA New
R9031 GGTGGCCTGCAGTAATGTTAG New
5 F8940 CCCCATACTAGTTATTATCGAAACC New
F9272 CTCAGCCCTCCTAATGACCTC New
R9376 CATTGGTATATGGTTAGTGTGTTGG New
F9483 TTCTTCGCAGGATTTTTCTGA New
R9611 GGATGTGTTTAGGAGTGGGACT New
R9853 GTGAGGAAAGTTGAGCCAATAA New
F9832 TTATTGGCTCAACTTTCCTCAC New
R10171 TAGAAAAATCCACCCCTTACGA New
F10267 CCCTCCTTTTACCCCTACCAT New
R10294 AGGGCTCATGGTAGGGGTAA New
F10419 AACAAAACGAATGATTTCGACTC New
F10689 GGCCTAGCCCTACTAGTCTCAA New
R10715 CGTAGTCTAGGCCATATGTGTTG [19]
R10942 TAGGGGGTCGGAGGAAAAG New
F10950 CCCTCCTAATACTAACTACCTGACTC New
R11166 CATCGGGTGATGATAGCCAAG [16, 17]
R11428 GGCTTCGACATGGGCTTT New
6 F11319 CAAACTCCTGAGCCAACAACTT New
F11760 ACGAACGCACTCACAGTCG [16, 17]
R11768 TGCGTTCGTAGTTTGAGTTTG New
R11804 GAAGTCCTTGAGAGAGGATTATGA New
F11964 TCACAGCCCTATACTCCCTCT New
R12089 TGGGGGATAGGTGTATGAACA New
F12194 CCCCTTATTTACCGAGAAAGC New
R12302 GCCTAAGACCAATGGATAGCT New
F12452 TTGTCGCATCCACCTTTATT New
F12741 CAACCTATTCCAACTGTTCATCG New
R12766 AGCCGATGAACAGTTGGAATA New
R13025 TGGAGACCTAATTGGGCTGA New
F13203 AGTCTGCGCCCTTACACAAA New
R13390 TGTTAAGGTTGTGGATGATGGA New
R13559 GCTCAGGCGTTTGTGTATGAT New
F13628 CTAACAGGTCAACCTCGCTTC New
R13855 GGTAGTTGAGGTCTAGGGCTGTT New
R13924 GGTAGAATCCGAGTATGTTGGAG New
7 F13835 CAGCCCTAGACCTCAACTACC New
F14058 CATCATCACCTCAACCCAAA New
R14118 TGGGAAGAAGAAAGAGAGGAAG [16, 17]
F14431 TGCCTCAGGATACTCCTCAAT New
R14448 GAGGAGTATCCTGAGGCATGG New
F14641 ACCCACACTCAACAGAAACAAA New
R14721 CGATGGTTTTTCATATCATTGG New
F14881 CACCACAGGACTATTCCTAGCC New
R14902 GGCTAGGAATAGTCCTGTGGTG New
F15190 CTTACTATCCGCCATCCCATA New
R15396 TTATCGGAATGGGAGGTGATTC [16, 17]
F15500 GACCCAGACAATTATACCCTAGCC New
R15585 ATTGTGTAGGCGAATAGGAAATA New
F15699 GCCCACTAAGCCAATCACTT [19]
R15728 GGAGTCAATAAAGTGATTGGCTTAG New
R16042 CTGCTTCCCCATGAAAGAAC [19]
8 F15971 TTAACTCCACCATTAGCACC [13]
F16190 CCCCATGCTTACAAGCAAGT [13]
F155 TATTTATCGCACCTACGTTC [13]
F314 CCGCTTCTGGCCACAGCACT [13]
R16410 GAGGATGGTGGTCAAGGGA [13]
R285 GTTATGATGTCTGTGTGGAA [13]
R484 TGAGATTAGTAGTATGGGAG [13]
R599 TTGAGGAGGTAAGCTACATA [13]
  1. Sequencing primers for the complete mtGenome, with sources (new or previously published). All primers for Amplicon 8, which covers the mtDNA CR, were adopted from [13]; these are used in duplicate to produce a total of sixteen sequences for the CR. Most amplification primers are also utilized as sequencing primers (see Table 1).