Skip to main content

Advertisement

Table 6 Primers of quantitative real-time PCR (qRT-PCR) validation of differentially expressed genes (DEGs)

From: Gene expression profiles responses to aphid feeding in chrysanthemum (Chrysanthemum morifolium)

Gene ID Forward primer Reverse primer Annotation
Unigene12209_All GTGGCTGAGATTGGTGGTTT GCCTTTACAAGCGTTTCAGC WRKY family transcription factor
Unigene14378_All TTAAGTCGGTTTTCGGCTTG GCATCCTCTTCGATCCTTTG WRKY family transcription factor
Unigene14705_All GACCGTCAAGAACAGGGGTA ATAGAAGGTCCCGCAAACCT Protein kinase
Unigene23047_All GCCACAAAATCCGTCAACTT GCCTAACGATCCCTTGTGAA SAUR family gene
Unigene22169_All GTCAAATGCTGCAAGGGATT ATCAACACTTGCCCGAAGAC Disease resistance protein
Unigene22508_All CGCGTTTCTTTCATTCCATT CGGTCGAACCCAGATTTAAG Kinase
Unigene32329_All TCGTACCGCTGGGAATTTAG TGGGCTCGACTCGACTACTT WRKY family transcription factor
Unigene23619_All ATGGGTGTTACAGGGATGGA ACACAGGAGAGCTCCAGGAA GRAS family transcription factor
Unigene29632_All CCTCCTAAGCTTCGCATCAC GCTGTTAACCGCTGACCAAT gibberellin-responsive protein
Unigene41060_All GTAATCTGGAGCATGGGTGG CTTAATGGTGTGCCCGTTTC GRAS family transcription factor
Unigene36228_All GGTTGTTTGGTTCTCGGAAA TACCAACAGTAACACCGCCA Protein kinase
Unigene41938_All GAGGATTTTCGCTGCCTTTA TCAACCACAAGAATGGAGCA WRKY family transcription factor
Unigene49088_All ACACTTTGTTTTCGGTTGGG GCAAGACCAACCATGAGGAT Protein kinase
Unigene55750_All ACCAGGATAAGGGAAGACGG TCCATCCCAAATTTCCAAAA protein with unknown function