Skip to main content

Table 2 Gene expression confirmed using RT-qPCR under oxygen conditions (condition O2)

From: Early adaptation to oxygen is key to the industrially important traits of Lactococcus lactis ssp. cremoris during milk fermentation

      Ratio of gene expression O2/N2 as determined by:
Locus tag Gene Gene product Primer sequences   Transcriptome analysis RT-qPCR
    Forward Reverse 1 h 5 h 8 h 1 h 5 h 8 h
llmg_0408 noxE NADH oxidase TTATGCCAAAGCAGAgGATTTT GGAATAATTGGACGTGAACCTG 22.9 −3.2   26.7 2.0  
llmg_0074 pdhA pyruvate dehydrogenase E1 component alpha subunit AGGACGTATGGGATTCTTTGG TTACCAAGTTGATGTCCACGAG 6.0 −2.3   7.7 2.8 4.1
llmg_1541 nrdH Glutaredoxin-like protein nrdH. AATTGTATGCAATGCAAAATGG ATTACAGGAGCAGCTCGAAAAC 10.3   2.8 28.3 4.7 6.9
llmg_0776 trxB2 thioredoxin reductase TGGTCTtTATGCGGCTTTTTAt GGTAAAGATTTTGtGGcTGACC 4.3    13.3 2.4  
llmg_2432 adhE alcohol-acetaldehyde dehydrogenase GGTTCTGAAGTGACTCCATTTG TCATAACAAACTCAGGGTCAACA −7.5    −8.55   
llmg_1464 adlC alpha-acetolactate decarboxylase GGCTGACCAACCTTATTTTACA TTCaGTgATGAAATTTTGGACA 4.6   3.7 11.8 2.3 4.8
llmg_1699 choS choline ABC transporter permease TTTTGCAAGTCACaGGAATTTTT GGaAAAATCGCATAAACAACAAG 3.6    10.0 4.1 3.1
lmg2144 lmg2144 conserved hypothetical protein TtGGcGGAATaaTAGGctgt cGTgCgtTgaAgAtAgAGACC 5.3 −4.3   9.0   2.7
lmg0274 lmg0274 conserved hypothetical protein CTCggTCATcGGAAAAGAAG TTtGTaGCTTgcTGCCAGAG 4.7 2.3 2.4 5.3   
llmg_0100 cadA cation-transporting ATPase TTTGGCTTTAATCAGCCTTTTT CCACCAGTAAAGTCGCAATAAT −4.1     2.1 3.5
llmg_0349 fhuD ferrichrome ABC transporter substrate binding protei CATTAGGTGCAAATGTTGTTGG TCAGGATTTTGAGCAATCAATTT 5.7    14.8 2.8 2.5
llmg_2050 tuf* translation elongation factor EF-Tu CACTCCATTCTTCGACAACTACC AGGCATTACCATTTCAGTTCCTT       
llmg_0102 parA* chromosome partitioning protein parA. TTcTACAgCCgATtATtGTTCGT TGGgATtGTTTCTAAtCCAGCTA       
llmg_0496 hllA* HU-like DNA-binding protein TTCAATTGATCGGTTTTGGTACT TCAATGCTTTACCAGCTTTGAAT       
  1. *tuf, parA and hllA expressions were used to normalised results.
  2. Fold-changes of differentially expressed genes, in O2 condition in comparison with N2 condition, confirmed using RT-qPCR with a p-value < 0.05 and a |fold-change| > 2 (n = 3). Genes parA, tuf and hllA were internal control genes.