Skip to main content

Table 3 Genes analysed by qRT-PCR

From: Cross-species toxicogenomic analyses and phenotypic anchoring in response to groundwater low-level pollution

Gene name Gene description Forward primer 5’-3’ Reverse primer 5’-3’
Cdkn1a Cyclin-dependent kinase inhibitor 1A (P21) atccagacattcagagccacag acgaagtcaaagttccaccgt
Hp Haptoglobin cttccagagagaggcaagaga gcccaactccacagcaaaaag
Lbp Lipopolysaccharide binding protein gcatccagacaaggcacaag cgaggtcgtggagctgaata
Pnrc1 Proline-rich nuclear receptor coactivator 1 ccacagacagcccccactc tgtataccatgcacaagctggc
Ppp1r3c Protein phosphatase 1, regulatory (inhibitor) subunit 3C caatgagctgcaccagaatga gtggtgaatgagccaagcaa
Sox9 SRY-box containing gene 9 tctggaggctgctgaacgag gcttgtccgttcttcaccga
Vtn Vitronectin agtgcaagccccaagtaacg ccgtccgtccgaggatttag
Nfe2l2 Nuclear factor, erythroid derived 2, like 2 gcatgatggacttggagttgc gctcatagtccttctgtcgct
Mavs Mitochondrial antiviral signaling protein tatccgagacaaccacagcaa gtcgatcaagatgactgggtg
C1qa Complement component 1, q subcomponent, alpha polypeptide tgtcccaccatcagcaaagg gtctccatggtgtccctgc
C1qb Complement component 1, q subcomponent, beta polypeptide gacccagacttccgctttct ctcaccccactgtgtcttca
C1qc Complement component 1, q subcomponent, C chain accctcaggatggtcgttgg tgagtggtagggccagaaga
Tub-α Tubulin-α caacaccttcttcagtgagacagg tacatgatctccttgccaatggt
LOC794625 Up-regulated during skeletal muscle growth protein 5 gggcaccagtttgcttgattg cctcctgccagtgattgtgt
Cpt2 Carnitine palmitoyltransferase II aaccgctggtacgacaa ggacgcaggctgagaac
Rpl13a Ribosomal protein L13A tctggaggactgtaagaggtatgc agacgcacaatcttgagagcag