Skip to main content

Table 2 Zur boxes of the MAP zinc regulon as predicted by FIMO analysis

From: Identification of a lineage specific zinc responsive genomic island in Mycobacterium avium ssp. paratuberculosis

Locus tag RCNa Positionb Zur boxc
MAP3778   −236 TGATAATGAAAATGATTTTCGTTA
MAP3772c   −30 CGTTAATGAAAATGATTATCATTA
MAP3770   −88 GCTTATTGAAAATGATTTTCGACA
   −33 TCGAGATGAAAATGATTCCCAATA
MAP3769c rpmG −283 TCTTGTCGAAAATCATTTTCAATA
   −338 CCTTATTGGGAATCATTTTCATCT
MAP3765   −270 GCTTACTGAAAATGATTGTTATTA
   −139 TGTTAACGAAAATCGTTTTCAGTA
MAP3764c pks2 −307 GTTTACTGAAAACGATTTTCGTTA
MAP3747c cobW −88 GCTTATTGAAAACGATTTTCGACA
   −33 GCTAGATGAAAACGATTGTCGATA
MAP3740 sidA −118 CGACAATGAAAATCGTTTTCAGTA
MAP3739c sidG −21 CCTTACTGAAAACGATTTTCATTG
MAP3737   −197 CCGTAATGAAAATGATTTTCATTA
   −248 GGTTATTGAAAATGACTTTCATTA
MAP3736c mptA −65d TGTTATCGATAACGATTTTCATTA
   −440d CTTTAATGAAAGTCATTTTCAATA
   −491d CCGTAATGAAAATCATTTTCATTA
MAP0489c   −66 TTGTAATGGAAACGATTTTCATTA
  1. aReference Common Name
  2. bPosition of the first base relative to the annotated translation start site [NCBI:NC_002944].
  3. cPutative Zur binding sites according to MEME-SUITE and FIMO analysis on the basis of MAP K-10 genome [NCBI:NC_002944].
  4. dPosition of the first base relative to the transcription start site determined by RACE experiments.