Skip to main content

Table 3 BCL11A and HBS1L-MYB minisequencing primers

From: Genotyping of BCL11A and HBS1L-MYB SNPs associated with fetal haemoglobin levels: a SNaPshot minisequencing approach

SNP Primer direction Minisequencing primers (5′-3′)a Size (bp) Concentration (μM) Detected allelesb
BCL11A      
rs11886868 F CAGAATCATTCTGCTCTGTG 20 0.02 G/A
rs4671393 F acaaGGAATCTTAATTTCCTGCAC 24 0.1 T/C
rs7557939 F aaCACCCTCTCTCACTCTTG 20 0.1 C/T
rs6732518 F aactaggtgccacgtcgtgaaagtctgacaaGACTCCTGAGAGCATGT 48 0.02 G/A
rs10189857 F gtctgacaaGCTTGTCACAGTTCTCTAC 28 0.2 T/C
rs6545816 F tctgacaaATTAAAATTAAGCCTCTTGCTTTT 32 0.05 T/G
rs7599488 R aactgactaaactaggtgccacgtcgtgaaagtctgacaaTTAGTCTCAGCCACCTG 57 0.2 G/A
rs1427407 F gtctgacaaTTCAAGTAGATATCAGAAGGGAA 32 0.1 A/C
rs766432 F aggtgccacgtcgtgaaagtctgacaaATGAATGACTTTTGTTGTATGTAAA 52 0.05 G/T
rs10184550 F ctgacaaTTGCTTTGATAAGTATCTATACAAATATT 36 0.05 C/T
rs7606173 F taggtgccacgtcgtgaaagtctgacaaTGTCCTGTGAGCGGTC 44 0.2 C/G
rs6706648 F acgtcgtgaaagtctgacaaCTTGCCTCCCCCTGAC 36 0.05 G/A
HBS1L-MYB      
rs28384513 F aggtgccacgtcgtgaaagtctgacaaTACCTACGCCAGCGTTC 44 0.15 T/G
rs7776054 F actaggtgccacgtcgtgaaagtctgacaaCAATATTTGTAATTTGTGTTCTGCTTCTAC 60 0.1 A/G
rs9399137 F CAATAATGTAATTAACTGAACATATGGTTATT 32 0.15 T/C
rs9389268 F GATTACAGGCGCATGCAACC 20 0.3 A/G
rs4895441 R actgactaaactaggtgccacgtcgtgaaagtctgacaaCTTACTCAGTTCTCTGCTCATGTA 63 0.1 A/G
rs6929404 F gtgaaagtctgacaaAAAAGTCTAGAGCACAAAAATTAAAATAA 44 0.1 C/A
rs9402686 F GTTTAAAGTGTGTGACCTTGAGAC 24 0.05 G/A
rs1320963 R agtctgacaaCTGAGAGTTCTTTTGGGATCTTTCAC 36 0.05 A/G
rs6904897 R tcaggtgccacgtcgtgaaagtctgacaaGTGTATTTCTTTTGGTTGTGCATACA 55 0.1 T/G
rs35959442 R gtctgacaaGCTCTTATAGCAGTCTACAGCAG 32 0.05 C/G
rs9376090 F AGTCTAGCTGAGTGTTAGCC 20 0.05 T/C
rs4895440 F GCGTGGCTGGGGAAAG 16 0.1 A/T
rs9494142 F ccacgtcgtgaaagtctgacaaCAGTCAATTCGATTCTACTACTGACA 48 0.05 T/C
rs9402685 F ccccccaactgactaaactaggtgccacgtcgtgaaagtctgacaaATGTTTCACCGTGTTGCTCAGG 68 0.1 T/C
rs11759553 F aaagtctgacaaTGATTGGGGTAGGCCATAGG 32 0.05 A/T
rs6934903 F tcaggtgccacgtcgtgaaagtctgacaaCCTGCATAAGTGTCGAATCTCTA 52 0.05 T/A
  1. aSmall letters indicate neutral sequence and poly(C) tail, and capital letters the specific target sequence.
  2. bDetected Major/Minor alleles.