Skip to main content

Table 4 Forward and reverse primers used for qPCR validation of RNA-seq

From: RNA-seq analysis of broiler liver transcriptome reveals novel responses to high ambient temperature

Gene Forward primer Reverse primer
SPSB4 5′ AATGGACTTGACCCGGAAC 3′ 5′ TTTCAGAGACAGAGGCAAAGG 3′
TRPC5 5′ CTGCCCTGGGTTCTAGGTTT 3′ 5′ GGGAGTTCATTGCAAAATCC 3′
BNC1 5′ TGGATATGTGCTGCAGGATG 3′ 5′ TGCCATTAACTCCACAATGG 3′
ANGPTL4 5′ TGTGACATGACTGCAGAAGG 3′ 5′ CAGCCAGAAGTCACCATGAA 3′
LIMS2 5′ CAGATGGGCTTTTCTATGAGTT 3′ 5′ GAAACATTCTGGGTGCCAGT 3′
ERC2 5′ GTCTTGCCTCAACACAGCAA 3′ 5′ GGCAATGTTTGCATCCTTTT 3′
S100A1 5′ AGCTGAGCAAGAAGGAGCTG 3′ 5′ GGTCCTGCATGATCTTCTCC 3′
FGF14 5′ TACCCAAGCCATTGGAAGTT 3′ 5′ GTTTGCCGCCATTCATTATT 3′
DIO3 5′ GCTCTCTTCCTTCGGGATCT 3′ 5′ CCCATTTCAAAATCGGTCAT 3′