Skip to main content

Table 2 Primers used

From: Deciphering regulatory variation of THI genes in alcoholic fermentation indicate an impact of Thi3p on PDC1 expression

Experiment Aim Name sens 5′-3′ sequence
THI3 allelic switch kanMX insert THI3_i_f Forward GAAAGAACATAACTACTAAAACGCACCGTCGTCATTCTGAAGATGTTTCGTACGCTGCAGGTCGAC
THI3_i_r Reverse GGTAATCATGAGGGTCCCTGGTAGTAGGGCGGAGAGATCAGATCAGCATAGGCCACTAGTGGATCTG
THI3-S288c insert THI3_A Forward TGCATTTGTCTTCTGCACACA
THI3_D Reverse TACAAAGTTGCGTGGTATCATCTTA
qPCR SCR1 sCR1_Cf Forward TCTGGTGCGGCAAGGTAGTT
sCR1_Cr Reverse CACCTTTGCTGACGCTGGAT
UBC6 UBC6_q_F Forward GGCTACAAAGCAGGCTCACAA
UBC6_q_R Reverse TGGAGGGTTTTCCACCATCA
THI11 THI11-qF Forward GGTGAATGGTTCGTCCAACAA
THI11-qR Reverse CAAGGCCCGTGGTTTCC
PDC1 PDC1-qF Forward CAGCACCCAAGGTAGCACCA
PDC1-qR Reverse AAACCACTTTCCCAAACAACACC
PDC5 PDC5-qF Forward AAGACTTGGACGATAGCGTATACATC
PDC5-qR Reverse CCAGCTAGAGTTCCAATTACCAAGT