Skip to main content

Table 1 Primers used for fine mapping of FOC1

From: Mapping and analysis of a novel candidate Fusarium wilt resistance gene FOC1 in Brassica oleracea

Primer Physical position on C06 Type Tm Sequences (5′-3′)
R7 38515717 SSR 58°C TCACTCCTCTCGCAGATTCA//TGGAATCGCTTTAAGCAGATGC
M10 38577450 InDel 55°C CACTTGCTCCAGTTTCTGTA//AACTATGGATAAAAGGCGTG
S3 38605567 InDel 55°C TTTCGGTTGACAGAGAAAGT//AGGAGAGAATCAAAAGCTCC
S4 38610913 InDel 55°C GGACTCACCTTTTTGTGTGT//AGATTACCCGTTTTCTCCTC
S6 38645784 InDel 55°C GGACTCCTTTGATCCTCTCT//GAATGCAACCATGTAAACAG
S7 38685934 InDel 55°C ACTTGACAGCTTTCCATCTG//TTTCTGCCCAGGTACTTAAA
V17 38743868 InDel 55°C GCAGATAATAATCCACACGTC//TACCACCTTTTTCTGGCTTA
S9 38827074 InDel 55°C CTGAAACTCGGGAATACATC//AAGCTTCCCACACTCTCTCT
V18 38828622 InDel 55°C TACAAGCTCCTTGTGGATTT//CAATCCTTGGCTGTTTTAAG
S12 38986625 InDel 55°C GCCCTCATTACGTTTAACAA//GAGTTGCAGCCTTCAAGTAT
A1 38988089 InDel 55°C TGACATAACCACTAGGAGCA//GCAGAAGCTTTGATGAAGTT
S13 39018573 InDel 55°C TGATGGACTGAAACCTAACC//AGGAGGATGAGGAAGAACC
V23 39029152 InDel 55°C CTCTTTATTGCAACGACACA//TCAATACGTCACTCATCACG
A2 39107094 InDel 55°C TGGTCTTTGGTCTCTTGTTT//AGCATTAACACTGACACCCT
A12 41310866 InDel 55°C GCGAACCGACCCTAGTAT//CAAAGCCAAGAAGGTGTTTA
A15 41982164 InDel 55°C GGTTTGAACCTCTGAAAATG//TGTGATTTCGGTTAGAGTCC
R3 42957515 SSR 58°C CGCTATGGATAATGTGTTCA//ATTAACAGCGAGGATAGCAA