Skip to main content

Table 2 Primers used on RNA-Seq validation

From: Flower development and sex specification in wild grapevine

Gene/annotationa Chromosome Primers (Forward/Reverse) Product size
VvAP1 (Vv01s0011g00100) 1 5’ – GAACAAGATCAATCGCCAAG – 3’ 128 bp
5’ – ACAGCTTTCCTTTAGTGGAG – 3’
VvAP3 (Vv18s0001g13460) 18 5’ – GAATTTGATGCAAGGGACAG – 3’ 169 bp
5’ – TAAAGGTCAAATCAGAGCCC – 3’
VvLfy (Vv17s0000g00150) 17 5’ – GAGAGGCAGAGGGAGCATCC – 3’ 210 bp
5’ – GCTTGCTCCCGCCTTCTTCGC – 3’
VvTFL (Vv06s0080g00290) 6 5’ – GTTGGTAGAGTGATTGG – 3’ 317 bp
5’ – GAAATGCCAAGGCCAAATAT – 3’
VvPi (Vv18s0001g01760) 18 5’ – GGAGAATGATAGCATGCAGA – 3’ 254 bp
5’ – TTTCCACCTCTCTCACATTG – 3’
  1. aThe ID of each gene present in the V. v. vinifera genome (12x_v1).