Skip to main content

Table 3 Novel miRNAs identified in the A line and B line of Brassica campestris by high-throughput sequencing

From: Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensi s by high-throughput sequencing and degradome analysis

miR_name miR_seq LM LP CG% dG MFEI FbA FbB
bra-miRn1-1-5p CTATCGGTCTACTCGGTCAGC 21 153 50 -131.5 1.2 19 7
bra-miRn1-1-3p TGACCGAGTAGACCGATAGTC 21 153 50 -131.5 1.2 87 222
bra-miRn1-2-5p CTATCGGTCTACTCGGTCAGC 21 153 47 -152.2 1.3 19 7
bra-miRn1-2-3p TGACCGAGTAGACCGATAGTC 21 153 47 -152.2 1.3 87 222
bra-miRn2-5p CAACAGTCTCAGGATGGAAAA 21 134 35 -47.6 1 3 12
bra-miRn2-3p TTTCATCTTAGAGAATGTTGTT 22 134 35 -47.6 1 57 153
bra-miRn3-5p TACAAAGCTGAAGCTAATTATG 22 141 41 -70.2 0.9 18 56
bra-miRn3-3p TAATCAGCTCCAGCTATGTACA 22 141 41 -70.2 0.9 145 175
bra-miRn4-5p GAATGATACTTGGATATGATC 21 147 34.7 -80.3 1.5 14 6
bra-miRn4-3p TTATATCCAAGTATCATTCCT 21 147 34.7 -80.3 1.5 15 34
bra-miRn5-5p TTCTAAGCTTTACGGGAAACC 21 201 29 -101.4 1.7 10 11
bra-miRn5-3p TTTCCCGTAAAGCTTAGAACC 21 201 29 -101.4 1.7 12 7
bra-miRn6-5p GTCAATTGGTGATAGTAGTTC 21 84 36.7 -38.3 1.2 11 41
bra-miRn6-3p TCTACTTTCACCAATTGGCCT 21 84 36.7 -38.3 1.2 4 54
bra-miRn7-5p TTTTGCGTTTCAACTCGGTCC 21 139 38.8 -64 0.9 73 61
bra-miRn7-3p GCTGAGTTGGAACACAAAATC 21 139 38.8 -64 0.9 19 8
bra-miRn8-5p AGAGATGTCTGGCTTGCAACA 21 140 44.5 -74.3 1.1 1 3
bra-miRn8-3p TTGCAAGCCAGACATTTCCTTT 22 140 44.5 -74.3 1.1 5 9
bra-miRn9-5p TTTGGATTTTGGTCATTGTTG 21 107 32.1 -50.7 1.4 0 2
bra-miRn9-3p ACAATGAACGAAATCCAAATC 21 107 32.1 -50.7 1.4 4 9
bra-miRn10-1-5p ACAGGTGGTGGAACAAATATGAGT 24 128 31.8 -52.5 1.3 1 13
bra-miRn10-1-3p TCATATTAGTTCTACCTCCTGCTG 24 128 31.8 -52.5 1.3 2 7
bra-miRn10-2-5p ACAGGTGGTGGAACAAATATGAGT 24 130 31.6 -44.4 1 1 13
bra-miRn10-2-3p TCATATTAGTTCTACCTCCTGCTG 24 130 31.6 -44.4 1 2 7
bra-miRn11-5p TGAGTCTCTCACCAGTCTTTCAC 23 117 34.1 -59.3 1.4 2 2
bra-miRn11-3p GAGAGACTCTGAAAGACTCACC 22 117 34.1 -59.3 1.4 8 5
bra-miRn12-5p TGTAATTGCGGGGTTCTAAGC 21 204 29.1 -103.6 1.7 7 9
bra-miRn12-3p TTAGAAACCTGCAATTATATA 21 204 29.1 -103.6 1.7 3 3
bra-miRn13-5p ACTATGCAATTGTGAACAAAC 21 128 29.5 -56.4 1.3 2 3
bra-miRn13-3p TTATTCACAACTGCATAATTC 21 128 29.5 -56.4 1.3 2 0
bra-miRn14-5p GGGAGCCAGGGAAGAGGCAGT 21 165 41.7 -66 0.9 0 2
bra-miRn14-3p TGCTTGTTCCCTGTCTCTCTC 21 165 41.7 -66 0.9 4 1
bra-miRn15-5p ACCCGTCTCTTAATTTTTAAC 21 161 31.7 -59.4 1.1 19 32
bra-miRn15-3p TAAAAGTTAAGAGACAAGTTA 21 161 31.7 -59.4 1.1 0 1
bra-miRn16-5p ATAAAACGATTACACAGCTCGGTC 24 230 42.1 -209.8 2.1 1 1
bra-miRn16-3p CGAGCTGTGTAATCGTTTTGTTA 23 230 42.1 -209.8 2.1 1 0
bra-miRn17-5p TCTCGTTCTCTCGTTTCAGCT 21 114 39.6 -56.6 1 0 3
bra-miRn17-3p CTGAAGCTAGTGAAAGAGAGA 21 114 39.6 -56.6 1 0 2
bra-miRn18-5p TTGTTGACAAATACTTAGGCTC 22 154 33.5 -121.6 1.7 3 7
bra-miRn18-3p GAGCCTAAGTATTTGTCAACAATG 24 154 33.5 -121.6 1.7 0 7
bra-miRn19-5p TAAACAACACATATACTTTGC 21 132 37 -89.6 1.8 0 2
bra-miRn19-3p AAACTATATGTGTTGCTTAGA 21 132 37 -89.6 1.8 1 0
bra-miRn20-5p AAGAACTCGTCTCTTAACTTTTAA 24 177 30.7 -86.7 1.2 1 5
bra-miRn20-3p AAACTAAGAGATGAATTCTTAC 22 177 30.7 -86.7 1.2 1 1
bra-miRn21-5p NGCGGATATCTTAGGATGAGGT 22 144 28.7 -55.8 1.3 0 1
bra-miRn21-3p TCATCGTAAGAGATCTGCATT 21 144 28.7 -55.8 1.3 0 1
bra-miRn22-5p TGAGTTATCATTGGTCTTGTG 21 186 28.1 -94.6 1.8 0 1
bra-miRn22-3p ACACAGGAACAATACTAACTCATT 24 186 28.1 -94.6 1.8 2664 4123
bra-miRn23-5p CTTTGTCTATCGTTTGGAAAAG 22 101 37.4 -37 0.9 25 95
bra-miRn23-3p TTTCCAAATGTAGACAAAGCT 21 101 37.4 -37 0.9 0 1
  1. miR_name, miRNA name; miR_seq, miRNA sequence; LM, length of mature miRNA; LP, length of precursor miRNA; dG, minimum free energy; MFEI, minimum folding free energy index; FbA, flower buds of A line; FbB, flower buds of B line.