Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 A partial list of novel miRNAs identified in bovine MAC-T cells with or without challenge with E. coli or S. aureus bacteria

From: Transcriptome microRNA profiling of bovine mammary epithelial cells challenged with Escherichia coli or Staphylococcus aureusbacteria reveals pathogen directed microRNA expression profiles

Mature miRNA ID1 miRBase Pre-miRNA2 miRBase miRNA3 5Score Mature reads Mature sequence Size Star reads Star sequence4 Size Precursor coordinate
bta-miR-1842-5p eca-mir-1842 eca-miR-1842 1180.4 2,172 uggcucugugaggucggcuca 21 142 agcaggccugucagggcguug 21 25:1744660..1744720:-
bta-miR-219-2-3p ssc-mir-219 ssc-miR-219 68.9 103 agaguugagucuggacgucccg 22 20 ugauuguccaaacgcaauuc 20 23:7335349..7335412:-
bta-miR-664-3p ssc-mir-664 ssc-miR-664-3p 68.5 70 uauucauuuaucucccagccuaca 24 59 caggcuaggagaaaugauuggau 23 16:24379875..24379936:-
bta-miR-6516-5p gga-mir-6516   9.6 10 uuugcaguaacaggugugaac 21 9 aucauguaugauacugcaaaca 22 19:55419754..55419817:+
bta-mir-2964a-3p bta-mir-219-1′ hsa-miR-2964a-3p 20.7 27 agaauugcguuuggacaaucagu 23 5 gauguccagccacaauucucg 21 11:98997166..98997230:+
bta-miR-3548-3p bta-mir-200a′ rno-miR-3548 6.6 2 cagcacuguccgguaagauguc 22 2 caucguuaccagacaguguuaga 23 16:52521338..52521399:+
bta-miR-194-1′-3p bta-mir-194-1′   30.4 56 acauggaguugcuguuacaaucg 23 3 aaguaacagcaucuccacugga 22 16:24306044..24306105:+
bta-miR-486′-5p bta-mir-486′   27.8 48 cccgguacugagcugacccgag 22 4 ucggggcagcucaguacaggac 22 27:36261849..36261912:+
bta-miR-374a′-5p bta-mir-374a′ bta-miR-374a-3p 26.1 50 uuacaauacaaccugauaagug 22 1 acuuaucagguuguauuaua 20 X:81951234..81951283:-
bta-miR-763′-3p bta-mir-763′   6.8 8 ucccagcuggucauuaauccu 21 3 gaauuaauggcuggcugggagg 22 5:48164035..48164101:+
bta-miR-191′-5p bta-mir-191′ bta-miR-191 5.5 40 gaacgaaauccaagcgcagcug 22 0 gcugcuuuugggauuccguugcc 23 22:51543481..51543545:-
bta-miR-1388′-3p bta-mir-1388′ bta-miR-1388-5p 1.8 405 uucucagguuggacaguccuga 22 0 cgggcugacaaaccugagauug 22 13:54375941..54376002:-
bta-miR-374b′-5p bta-mir-374b′ bta-miR-374-3p 1.4 60 ugauaauacaaccugauaagug 22 0 cuuagcagguuguauuauaucc 22 X:82023929..82023981:-
bta-miR-194-2′-3p bta-mir-194-2′ bta-miR-194 4.8 10 cacauggaguugcuguuaca 20 0 uaacagcagccccacugga 19 29:43731473..43731526:-
bta-miR-590-3p eca-mir-590   1.4 13 uaguuuuauguguaagcucguu 22 0 cgagcuuauucacagaaguaca 22 25:33713356..33713419:-
bta-miR-222b-3p   bta-miR-222 4.9 20 ugcuacaucuggcuacugga 20 0 ggguggacgcuguguggcugagc 23 10:78769129..78769183:+
  1. 1“`”represents the antisense of miRNA precursor; the star sequence of miR-219-2 is miR-219-5p in miRBase (Release 19);
  2. 2The top known miRNA precursor (miRBase Release 19) aligns to novel precursor with > 70 identity and > 75 sequence length;
  3. 3The top known miRNA (miRBase Release 19) matches novel miRNA covering > 90 identity and > 90 sequence length;
  4. 4Sequence here only shows the dominant one and the star sequence that was absent was predicted by miRDeep2.
  5. 5miRNA with score less than 5 is identified from miRNA candidate precursor.
Back to article page