Skip to main content

Table 5 Primers and annealing temperatures for ompA and p-ompA

From: Gene polymorphism analysis of Yersinia enterocoliticaouter membrane protein A and putative outer membrane protein A family protein

Target gene Primer direction Primer Sequences (5′ → 3′) GenBank no. Location Amplicon lengt Annealing temp
ompA Forward ACATCACACTTGTAACTTTCTCACC YP_001005874.1 1783285-1783261 1451 bp 58°C
  Reverse AGAAGTATCAGAATCAGATGTCGTC   1781835-1781859   
p-ompA Forward GCGGCAAATTCCGTACAGTG YP_001006877.1 2919405-2919386 1560 bp 60°C
  Reverse CAGCCCACCAGCAATATTCG   2917806-2917825