ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium

Picossi, Silvia; Flores, Enrique; Herrero, Antonia

doi:10.1186/1471-2164-15-22

Table 2 Top-scoring target regions

From: ChIP analysis unravels an exceptionally wide distribution of DNA binding sites for the NtcA transcription factor in a heterocyst-forming cyanobacterium

ID	NLQ^a	Start	End	Gene	Description	NtcA bs^b	Putative NtcA binding site and promoter sequences^c
1203	8186.60	3561438	3561710	alr2921*	tRNA modif. prot.	3561528	GTGTGTCTTGATAC AATACTTTTAAGATGACTGTTATATGCT TTCTAAG
1856	7861.39	5515960	5516178	all4613	IlvG	5516125	GAATTACTGACTAC AGAATTCCCGCATTAACTTAGCTATCAT CTGAGGTT
						5516125	GAATT A CTGACTAC
1152	7152.53	3427339	3427611	alr2817	HetC [26]	3427445	*GTAACATGAGATAC* ACAATAGCATTTATATTTGCTTTAGTAT CTCTCTC
390	6288.90	1156154	1156424	alr0990	Amt4 [21]	1156258	GTATTAACTAATAC AGAATTAATGTTTAGGTAAATAGACAAT CAATC
798	5358.67	2400656	2400888	all2006	Unknown protein	2400815	GTATATTTCAACAC GAATTTGATCATTTAGATGGTGTACTGT TTATAGA
931	4728.32	2807226	2807511	alr2328	GlnA (RNA_I) [27]	2807342	*GTAACAAAGACTAC* AAAACTGTCTAATGTTTAGAATCTACGAT ATTTCA
					GlnA (RNA_II) [27]	2807342	*GTAACAAAGACTAC* AAT CCAGACGTTCT
1612	4089.39	4795414	4795682	asl3981	Unknown protein	4795535	G GATTTTGTAGCTATCACTAC
						4795535	GTAGCTATCACTAC AATCTATAGCTTGAAAGAGGAGGAAAAT AGGTTGG
293	3663.48	815417	815662	alr0709	Fe-responsive RR [25]	815545	GTATAAATTTTTAC
364	3580.62	1070920	1071178	all0926 ^§	PilL	1071039	GTAGCCCCTGCTAC
1764	3570.57	5243203	5243472	all4376	SpsB [28]	5243396	GTATTGAAAATTAC AAAAATCTTATTTACTTATTAGTAACAT TGGTGAC
1165	3408.52	3463447	3463731	all2842 ^§	Unknown protein	3463590	GTTACACCTGCTAC
1125	3369.20	3341106	3341375	alr2743	Processing protease	3341205	GTATAACTTGATGC GAATTTGGCGATCGTTCAGAGTTAAGAT CACAAACA
1530	3353.43	4573161	4573410	asl3784	hypothetical protein	4573340	GTTAAATAGATTAC AAAACTCTGGATGGACTTTGAGTATCAT TTAGATA
932	3292.44	2809205	2809466	asl2329	GifA [29]	2809350	*GTAGCATAAGATAC* AGAATTCTTGCTATATT AAATGTG
2098	3220.20	6294152	6294404	alr5275	Gnd	6294223	GTTGATTTGGATAC AAATTAAAACTATTTATCTGTGTTACTAGTGAGCTTTTA
				all5274	Hypothetical protein	6294223	GTATCCAAATCAAC AATTAACTTGTAAAAT TTGCGA
319	3192.18	902825	903070	all0778	Ser protease inhibitor	902941	GTAGCCATGAATAC
1150	3126.82	3420486	3420738	alr2811	AvtA	3420576	GCTGAGATTGGTAC
2232	2974.32	264949^†	265189^†	alr7243 ^§	Similar to ankyrin	265067^†	GTAGCCTGTGATAC
898	2824.47	2729431	2729698	all2267	Hypothetical protein	2729550	GTATTGCTGGCTAC
1858	2807.34	5523157	5523405	all4620 ^a	Na⁺/H⁺-exch. prot.	5523288	GTATAAGCTGTAAC
1255	2798.00	3732951	3733219	all3084	Hypothetical protein	3733071	GTTAAAATGACGAC ATTTTAATAAAAAGAAGCATATACT CGATGTA
260	2698.90	701137	701391	all0602	NtcB [30]	701297	*GTAACAAAATCTAC* CAAATTGGGGAGCAAAATCAGCTAACTT AATTGAA
377	2641.34	1111093	1111337	all0956	Unknown protein	1111206	GTAGCATAGACAAC
				alr0957	FurC [31]	1111206	GTAGCATAGACAAC
519	2592.23	1576957	1577227	asr1328	Hypothetical protein	1577115	GTAACATACACTAC GAAACTTATGCTATGTT AGGAAGAA
2149	2572.01	23295^†	23563^†	all7026 ^§	DNA binding protein	23435^†	GTATTCGCTGATAC
554	2517.34	1669629	1669873	alr1404	Ser acetyltransferase	1669702	GTGACTGGGGATAC AGAAAATTTATTTATAGTCCTGTCTACTGT ATATTC
1784	2362.05	5312632	5312908	all4432 ^§	EPS biosynthesis	5312767	GTATCAACTGCTAC
1660	2280.02	4946500	4946770	alr4105 ^§	2-comp. sensor HK	4946621	GTAGCAGGTTATAC
2345	2253.01	105303^‡	105553^‡	all7614	Putative porin, OprB-II	81139^‡	GTATGAAATAGTAC AGTTTAAAATTAGTGTTTGCGTCATCAT TACGAGA
38	2141.66	69752	69991	asr0064	Hypothetical protein	69882	A GTTCCGTATAGCAAAATAC
1118	2134.47	3325955	3326229	alr2729*	cox3 operon	3326057	GTTACTAAAGATAC AGTATTTTCTAGCTTTTAAATTTTGAAT ACAAAGA
1283	2115.10	3807024	3807271	all3144	Hypothetical protein	3807189	GTATCGACCATTAC
94	2063.99	210284	210541	alr0194	Hypothetical protein	210417	GTATTACCTAATAC
				all0193	Haloalkane dehalogenase	210417	GTATTACCTAATAC
1316	1948.08	3903915	3904189	all3232	2-comp. RR	3904009	GTAACCAAATATAC
				alr3233	TrpE	3904009	GTAACCAAATATAC
262	1927.75	704040	704304	alr0607	NirA [32]	704169	*GTAGCTACTTATAC* TATTTTACCTGAGATCCCGACATAACCT TAGAA
729	1908.73	2158958	2159198	all1797	Unknown protein	2159129	GTATCCTCTGCTGC TGCACTAGAAGTTTGTTCAAGGTTTAAT TGTAATA
1923	1885.93	5718871	5719130	alr4800	Anti-σ antagonist	5718952	GATACGATTGATAC CGAAATCCTTAGGCGTTTGTGCCTATATT GAGAAAA
2111	1840.96	6328022	6328296	alr5307	Glycosyl transferase	6328115	GTAGTTTTCGCTAC
				all5306	Exodeoxyribonuclease III	6328115	GTAGTTTTCGCTAC
695	1791.79	2058723	2059007	alr1713*	Hypothetical protein	2058829	GTAACCTATAAGAC ATTTTATTTGATACCTCATACTCTAAAAT CAAGTA
776	1744.65	2304064	2304320	alr1921 ^§	Biotin synthase	2304193	GAAGTGTGCTGTAC

†Genomic positions within the alpha plasmid. ‡Genomic positions within the beta plasmid.
^§Target regions located in internal positions of the ascribed genes. All the other target regions are upstream of the ascribed genes. The genes marked with * could be ascribed to sRNAs located in the upstream region of the indicated genes.
^aNLQ: Indication of the statistical significance of the peak identifying the binding region.
^bPosition in the chromosome/plasmids of the first nucleotide of the putative NtcA binding sites.
^cThe putative NtcA binding sites, -10 boxes and TSPs are in italics. Those that have been previously described are indicated in bold. In some cases, the detected NtcA-binding site could be associated to two TSPs, either of the same gene or of two divergent genes.

Back to article page

ISSN: 1471-2164

Contact us

Submission enquiries: bmcgenomics@biomedcentral.com
General enquiries: ORSupport@springernature.com

BMC Genomics

Contact us