Skip to main content

Table 1 Bovine specific oligonucleotide forward and reverse primer sequences (5′-3′) and PCR product length

From: Global gene expression in endometrium of high and low fertility heifers during the mid-luteal phase of the estrous cycle

Gene name Sequence Accession number Amplicon size (bp)
18S/28S F: 5′- TGCTCTCGCAAACCTAACCT-3′ DQ222453 159
R: 5′- CACTAAGCACTCGCATTCCA-3′
ACTA2 F: 5′- ACTGGGACGACATGGAAAAG -3′ BT021508 166
R: 5′- TACATGGCTGGGACATTGAA-3′
ACTB F: 5′- ACTTGCGCAGAAAACGAGAT-3′ BT030480 121
R: 5′-CACCTTCACCGTTCCAGTTT-3′
APEH F: 5′- CAAGAGCATGCGCAGTATGT -3′ BC123400 181
R: 5′- GTAGAGCTGCAAAGCCCATC-3′
CELA1 F: 5′- GGAACCATCCTGGCTAACAA -3′ BC149525 165
R: 5′- CATGGTGGTCTTCACAGTGG -3′
DONSON F: 5′- TGTGTTGGTGAAGGGAATGA -3′ BC133573.1 107
R: 5′- AGAGGGTTGGTGGAAGTCCT -3′
FST F: 5′- TAAATGAGAGACCCGCCAAC-3′ AY775795 171
R: 5′- CCCCAGTTTCTGTCCTGTGT-3′
GALNT6 F: 5′- GACCACGTCTTGGACCTCAT-3′ NM_001015534 146
R: 5′- AGCTCAGCTGGGGTGTAGAA-3′
GAPDH F: 5′- GGGTCATCATCTCTGCACCT-3′ NM_001034034 176
R: 5′- GGTCATAAGTCCCTCCACGA-3′
GJA1 F: 5′- - CAACATGGGTGACTGGAGTG 3′ BT021508 110
R: 5′- GCAGGATTCGGAAAATGAAA -3′
IL33 F: 5′- TTGTTTTGGAGGATGGAAGC -3′ BC123562 163
R: 5′- TTTGTGGGGCTCAGGTTTAC -3′
MMP19 F: 5′- TGGACGTTATCCCCTCAGTC-3′ BC123722 119
R: 5′- GTCCATGGTTCATGCTTGTG -3′
MOSC2 F: 5′- GCAGTGCTTTTGAGGAGGAC-3′ NM_001076380 169
R: 5′- GGATCACACAGGCGGTAACT-3′
NMB F: 5′- ACATGACGACATGGCTGAAA-3′ NM_001075270 185
R: 5′- ACTTCAACAGGGAAGCGAGA-3′
NPPC F: 5′- GAGGCAACAAGAAGGGTTTG -3′ BC123399 149
R: 5′- CTGATGACCAAGGGTGACCT -3′
PPARA F: 5′- TTGTGGCTGCTATCATTTGC-3′ AF229356 135
R: 5′- AGAGGAAGACGTCGTCAGGA-3′
RAB3B F: 5′- TGGGCGGAGATTCATTTTAC -3′ BC112795 144
R: 5′- GAAAAGTGTGCATGGGTGTG -3′
RPL15 F: 5′- TGCATAAGCACAGGGAGATG-3′ BT020706 134
R: 5′-CTGGAGAGTATTGCGCCTTC-3′
SFRP1 F: 5′- GTCCCTCTGGGTGAATCTGA-3′ NM_174460 158
R: 5′- TCACTAATTGCCAGGGGTTC-3′
SLC1A3 F: 5′-CATCCATGCTGTCATTGTCC-3′ BC120125 188
R: 5′-ATCTGGTAACGCGTTTGTCC -3′
SLC45A2 F: 5′- CATGCCCTCTTCACAGGTTT-3′ XM_001251343 179
R: 5′- AGTGGGGCTTCAGGGATACT -3′
TGFB1I1 F: 5′- CCTGCAATAAACCCATTGCT-3′ NM_001035313 162
R: 5′- AGAAGCGCTCGAAGTAGCAC-3′
UBQ F: 5′- TACAACAGTTGGTGGCCAAA-3′ BC102888 121
R: 5′-GAAGACTGGGCTGACTGAGG-3′
  1. 18S/28S, 18S/28S ribosomal RNA; ACTA2, actin alpha 2; ACTB, beta-actin; APEH, N-acylaminoacyl-peptide Hydrolase; CELA1, chymotrypsin-like elastase family member 1; DONSON, downstream neighbor of SON; FST, follistatin; GALNT6, UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GJA1, gap junction protein, alpha 1; IL33, interleukin 33; MMP19, matrix metallopeptidase 19; MOSC2, MOCO sulphurase C-terminal domain containing 2; NMB, neuromedin B; NPPC, natriuretic peptide C; PPARA, peroxisome proliferator-activated receptor alpha; RAB3B, RAB3B member ras oncogene family; RPL15, ribosomal protein L15; SFRP1, secreted frizzled-related protein 1; SLC1A3, solute carrier family 1 member 3; SLC45A2, solute carrier family 45 member 2; TGFB1I1, transforming growth factor beta 1 induced transcript 1; UBQ, ubiquitin.