Skip to main content

Table 3 Novel miRNA candidates in ‘Ventura’

From: High throughput sequencing of two celery varieties small RNAs identifies microRNAs involved in temperature stress response

miRNA ID Sequence (5′-3′) Length(nt) Start/end precursor Length of precursors(nt) Arm MFE (kcal/mol)
celery-miR-6 ACGGAACCAGGATTTTTGATGTCC 24 95-195 101 5′ −30.30
celery-miR-13 ATTTGCTGTTAACGGGGTTCGAAC 24 213-301 89 3′ −27.90
celery-miR-18 GTTAGTAGAAACAGATCCAAT 21 392-489 98 3′ −45.20
celery-miR-22 TAGGAAGACTGTTCTCAGTGA 21 82-170 89 5′ −27.30
celery-miR-27 TTTAGCTTGAACTATAGATT 20 1522-1617 96 3′ −24.90