Skip to main content

Table 2 Sequence information for transcripts selected for the quantitative PCR validation of oligoarray data

From: Characterization of the transcriptome and temperature-induced differential gene expression in QPX, the thraustochytrid parasite of hard clams

Sequence name Sequence ID Sequence description Primer sequences Top blast match
Acc. no. E-value
C1A-1 qpx_c534 Cysteine peptidase F: ACGGCAATGTTACCGAAGAGGCTA XP_002507788 1.6E-48
   R: TAGTTATCCAATGGGCCCGCGTTA   
C1A-2 qpx_c5487 Cysteine peptidase F: ACTGGAGCAAGAAGGGAGCAGTAA CBJ28832 1.9E-29
   R: AAGACCACCTGTGGTGGAGAAACT   
C1A-3 qpx_c3110 Cysteine peptidase F: TGCAGGTCGTCGTTGCTTTAGTCT EAY93080 3.8E-14
   R: TAGCCAACGATTGAAACTGCGTGG   
S8-1 qpx_c765 Serine peptidase F: TCGTGCTGGACACATAGTTGTCGT ABI79453 6.3E-30
   R: TATCGGTGGCTCCAACGCTTATCA   
S8-2 qpx_c1822 Serine peptidase F: TATGGCTACTCCATTTGTCGCTGG ABI79453 1.9E-29
   R: ACGAGCAAATTGGGAGATTCGTGC   
S8-3 qpx_c2550 Serine peptidase F: AAGAGCGGTTGGGAATATGGGAGT ABI79453 7.5E-51
   R: AACAACAAGCATGCCCTCTTCTGC   
S01B qpx_c674 Serine peptidase F: AGGTCTACGTATGGCTCCACTTCA XP_002906640 1.7E-22
   R: TTGAGCCCACATTTCTCAGCAGGA   
Actin qpx_c116 Actin F: TGAAGATCTTGACCGAGCGTGGTT ABC85743 1.0E-173
    R: AGCGGTCTTCATCTCCTGGTCAAA