Skip to main content

Table 1 PCR and Taqman qPCR oligonucleotides used in this study

From: Knockout of an outer membrane protein operon of Anaplasma marginale by transposon mutagenesis

Oligonucleotide sequence (5’ to 3’) Target Size Reference
PCR     
AB1553 CTCCAATCGGAGGGGTTGTG omp6 492bp [43]
AB1554 GCATAAATCCAGTTTAGCCTCC
AB1555 GTGGTTAGATCTTTTCTGTTGGG omp7 399bp [43]
AB1556 CGCTCTACCACTGACCTTCATG
AB1591 GCTGGAGTTCGAAGCGATGC omp8 259bp This study
AB1592 CAGAGCGCCCTGTTTCAGTG
AB1559 AGCTGGGGCTCTTGCGTTTG omp9 1096bp [43]
AB1560 AACATATTCACTATAATCTGACGCTGC
AB1561 TCCTTCGGGTTGCTGCGTTG omp10 969bp [43]
AB1562 GCTTACCCCCATTCCAGCAC
AB1572 AGGATGATCAGCCACACTGGAA 16S 131bp This study
AB1573 TACAACCCTAAGGCCTTCCTCA
**qPCR
AB1591 GCTGGAGTTCGAAGCGATGC
AB1592 CAGAGCGCCCTGTTTCAGTG omp8 259bp This study
AB1593 GCGTGAGCACTGCGGTACAGACGG
AB1581 GAAGTCACTACACGACCTGACTGT
AB1582 TAAAGCATCTTCGCGGGTCGT omp9 145bp [43]
AB1583 TATTCAGTGCGCTGAACACTGCGATCCA
AB1594 GTGGGTGCTGTACGCACATT
AB1595 AAAGACAGCAGGCAGCAACA omp10-5' 170bp This study
AB1596 CGCGTGTCCTTCGGGTTGCT
AB1569 GGTGCTGAGTTGAAGCTTGC
AB1570 GCCACAGACCCACTATCAGC omp10-3' 140bp [43]
AB1571 TATCTCGCGCTGCATCGGTG
AB1572 AGGATGATCAGCCACACTGGAA
AB1573 TACAACCCTAAGGCCTTCCTCA 16S 131bp [42]
AB1574 TATTGGACAATGGGCGCAAGCCTGAT
AB1606 CTCACAGGCGAAGAAGCAGAC
AB1607 GCCCGACATACCTGCCTTT msp5 145bp [55]
AB1610 TGGGCGACAAGAAGCCAAGTGA
AB1608 ATCAAAGCTATTGCGGAGGA
AB1607 ACAGAACTCTCCCCATGCAC rpoH 116bp This study
AB1611 TGCCAATCGGGACGTTTCGC
AB1242 AAAACAGGCTTACCGCTCCAA
AB1243 GGCGTGTAGCTAGGCTCAAAGT opag2 151bp [41]
AB1250 CTCTCCTCTGCTCAGGGCTCTGCG
  1. *Primers and TaqMan probes used were manufactured at Eurofins MGM Operon.
  2. Oligonucleotides are labeled with 6-Carboxyfluorescein 6-FAM at the 5’ end and Tetramethylrhodamine TAMRA at the 3’ end.