Figure 2

Major RRBS library construction steps. This figure demonstrates adaptor ligation (step 1) and barcode indexing (step 2) for Illumina two-step library preparation, as well as in between steps including bisulfite treatment. We show how the 2-step procedure affects DNA inserts when used for RRBS directional sequencing. First, DNA inserts (underlined) with ‘A’ overhangs are ligated to methylated Illumina adaptors (methylated cytosines are marked in bold), meC-PE1 and meC-PE2. Next, adaptor ligated-DNA inserts are bisulfite treated and amplified using primer indPEPCR1F and indPEPCR2R. All unmethylated cytosines deaminate to uracil. We show two cycles of the PCR reaction toamplify bisulfite fragments to show how DNA inserts change after bisulfite treatment and amplification, as well as to track original top (OT) and original bottom (OB) strands. After an appropriate number of cycles (appropriate is defined by the visualization of bands shown in this manuscript in the library preparation stage), bisulfite treated libraries can be indexed, then sent for sequencing. Note that for directional sequencing all sequencing reads are either from the original top (OT) or the original bottom (OB) strands. The first three bases of almost all RRBS reads are either CGG or TGG, depending on their genomic methylation state and this applies to reads generated from both OT and OB strand. Therefore almost every read in a directional RRBS sequencing experiment that use MspI digestion contains at least one CpG at the 2nd and 3rd base positions, plus any internal CpGs (provided they are not in CCGG or CCGG sequences). Internal CpGs can be in CCGG sequence where MspI does not cut when the first C is methylated. Abbreviations: C (Bold): methylated C; p: phosphate; s: phosphorothioate bond. Illustrated insert DNA is underlined. P5 (5′ AATGATACGGCGACCACCGA 3′) and P7 (5′ CAAGCAGAAGACGGCATACGA 3′) are flow cell attachment sites.