Skip to main content

Table 2 Primers used for qPCR analysis

From: The battle of the sexes starts in the oviduct: modulation of oviductal transcriptome by X and Y-bearing spermatozoa

Gene symbol Affymetrix porcine probe Primer Sequence Product size (pb)
CCL8 SSc.9957.1.A1_at Forward 5′ GCGAGATGGCATTTCTCTCT 3′ 119
Reverse 5′ CACACTTCGGCTTACAAGAGG3′
IRF7 SSc.2573.9.1_S1_at Forward 5′ GCTGGATGAAGCCAGAACA 3′ 97
Reverse 5′ GGCCCAGGCCTTAAAGAT 3′
Ubiquitin B Reference gene Forward 5′ GTCTGAGGGGTGGCTGCTAA 3′ 85
Reverse 5′ TGGGGCAAATGGCTAGAGTG 3′
β-actin Reference gene Forward 5′ CCTCCCTGGAGAAGAGCTA 3′ 131
   Reverse 5′ CTTCATGATGGAGTTGAAGGT 3′