Skip to main content

Table 1 MLPA probe sequences used for targeting the CCL3L1 gene and two reference loci EP300 and CREBBP

From: Technical considerations for genotyping multi-allelic copy number variation (CNV), in regions of segmental duplication

Probe Left probe Right probe
CCL3L1 GACTCTTGGCTCTGCTGACACTCGAGCCCACATTCCATCACCTGCTCCC AATCATGCAGGTCTCCACTGCTGCCCTTGCC
exon 1
CCL3L1 CCTCCACCTTCCCTCACAGTGT GTCTGGTGACAACCGAGTGGCT
exon 3
CREBBP CCAGCTAGTGGAATTCAAAACACAATTGGTTCTGTTGGCACA GGGCAACAGAATGCCACTTCTTTAAGTAACCC
EP300 CCAACCTAAGCACTGTTAGTCAGATTGATCCCAGCTCCAT AGAAAGAGCCTATGCAGCTCTTGGACTACCCTATCA