From: Transcriptome profiling of granulosa cells from bovine ovarian follicles during atresia
Target | Primer sequences, 5′-3′ | GenBank accession number | PCR reaction conditions |
---|---|---|---|
CYP17A1 | forward accatcagagaagtgctccgaa | NM_174304 | 2 min 50°C, 10 min 95°C, 40 × cycles of 15 s 95°C and 60 s 60°C |
reverse ccacaacgtctgtgcctttgt | |||
18S | forward agaaacggctaccacatccaa | DQ2224 | 2 min 50°C, 10 min 95°C, 40 × cycles of 15 s 95°C and 60 s 60°C |
 | reverse cctgtattgttatttttcgt |  |  |