Skip to main content

Advertisement

Table 9 Primers and conditions used for quantitative RT-PCR

From: Transcriptome profiling of granulosa cells from bovine ovarian follicles during atresia

Target Primer sequences, 5′-3′ GenBank accession number PCR reaction conditions
CYP17A1 forward accatcagagaagtgctccgaa NM_174304 2 min 50°C, 10 min 95°C, 40 × cycles of 15 s 95°C and 60 s 60°C
reverse ccacaacgtctgtgcctttgt
18S forward agaaacggctaccacatccaa DQ2224 2 min 50°C, 10 min 95°C, 40 × cycles of 15 s 95°C and 60 s 60°C
  reverse cctgtattgttatttttcgt