Skip to main content

Table 6 Information on the primer pairs used for quantitative real-time PCR analysis

From: Longissimus dorsi transcriptome analysis of purebred and crossbred Iberian pigs differing in muscle characteristics

Gene symbol Gene name Genbank Acc. number Primer sequences 5′-3′ Amplicon size (bp) Efficiency (%)
IGF2 Insulin-like growth factor 2 NM213883 GCCGCTGCTCGTGCTGCTCGTCTT 151 86
GCTTGCCGGCCTGCTGAA
KERA Keratocan XM001927128 GTGGCCTTCCTGAGACTAAACC 198 89
AGGGCATATCACAGAGACATTCAC
FMOD Fibromodullin XM003130105 GCTGCTATATGTGCGGCTGTC 194 93
AGAAACTGCTAATGGAGAACT
COL1A1 Collagen alpha-1 EF136662 AGCCCAGCGTGCCCCAGAAGAA 164 88
ACATCAGGCGCAGGAAGGTCAGC
FBN2 Fibrillin 2 XM003123897 GGACGCTGCATACCTACTGT 201 96
AATGCATGCTTGCTTGGTAGG
AEBP1 AE binding protein 1 XM003134886 CGGCGGCATGGGCATCGTCAAC 233 90
TGCCCTGCTCGTCCGTCACTACCC
LOX Lysyl oxidase NM001206403 CTGAGATGCGCTGCGGAGGAAAAC 223 88
TGGCATCAAGCAGGTCGTAGTGG
FKBP14 FK506 binding protein 14 XM005673279 TTCCGGAACTTCTTTCCTGCTCT 250 91
GGCTGACCATTGTTATGTTTGTGA
PSMD11 Proteasome 26S subunit, non-ATPase XM003131741 TCTTACGCCAGGCTTTGGAG 219 91
CTGTGGTTCGAGCAGAGGTT
ALOX5AP Arachidonate 5-lipoxygenase-activating protein NM001164001 TGGACTGATGTACCTGTTTGTGAG 213 94
AGAGGGGAGACGGTGGTGGTGA
CASP4 Caspase 4 XM003129812 AATATGCTTGGCGCTGTCAC 190 97
TGGTGCTTCTCGAAGTTGGT
ELOVL6 Fatty acid elongase 6 XR305072 AGAACACGTAGCGACTCCGAAGAT 182 96
GACATGCCGACCGCCAAAGATAA
NFKBIZ NF-kappa-B inhibitor zeta-like XM003132694 TATGATGGCCTGACTCCTCTACAC 196 91
TGCGGCCACTTTTACGAT
ME1 Malic Enzyme XM001924333 TTTCCTGGAGTTGCCCTTGGTGT 213 90
GGTGGCTGTCTTTTCTTGGTATGC
PLA1A Phospholipase A1 member A XM003483312 TGTGGGCAGCTAGTGGAAGAAAGT 215 91
TCCACGGCTGAAAAGTAGACACC
PON3 Paraoxonase 3 HQ542303 ACGGGAGATATTTGGGCAGG 142 92
TGTTGGCATACTCGGTGCTT
SCD Stearoyl-CoA desaturase JN613287 TCCCGACGTGGCTTTTTCTTCTC 205 90
CTTCACCCCAGCAATACCAG
ELOVL5 Fatty acid elongase 5 ENSSSCG00000024149 CTTGCCGGGGGATTTTGGTTG 223 82
TTGCGCAGGATGAAGAAGAAGGTG
DLK1 Delta-like 1 homolog NM_001048187 CGGGCCCTGCGTGATGAATGG 208 83
AGGGCAGCGGCAGCGGAAGTC