Endogenous small-noncoding RNAs and their roles in chilling response and stress acclimation in Cassava

Xia, Jing; Zeng, Changying; Chen, Zheng; Zhang, Kevin; Chen, Xin; Zhou, Yufei; Song, Shun; Lu, Cheng; Yang, Ruiju; Yang, Zi; Zhou, Junfei; Peng, Hai; Wang, Wenquan; Peng, Ming; Zhang, Weixiong

doi:10.1186/1471-2164-15-634

BMC Genomics

Table 1 Novel miRNAs in Cassava and castor bean identified from small-RNA profiling

From: Endogenous small-noncoding RNAs and their roles in chilling response and stress acclimation in Cassava

No.	Mature_sequence	#. Reads	WGS_ID	Start	End	Strd.	Genomic region	Validation	Name
(A) Twenty-two novel miRNAs were identified and experimental validated in Cassava
1	UGGACGCCAUUUUGACAGAUG	248	scaffold00847	1153336	1153495	+	Intergenic	N	novel-3
2	CAAAUUAUAAUGGCAUUUUGA	11	scaffold02022	100612	100777	+	Intergenic	nd	novel-10
3	UGGGUAAGUGGGGAAGAUAAC	90	scaffold02264	510281	510416	+	Intergenic	N	novel-11
4	AAAUGGGACUCAUCAUAUGGUGGG	50	scaffold02658	994069	994318	+	intron.2_Cassava 4.1_019698m.g	Y	novel-14
5	UGGCCUAGAGUAGUGACCUCC	346	scaffold02936	84627	84693	-	Intergenic	Y	novel-16
6	AGAUGGGUGGCUCGGGAAGAAG	21209	scaffold03604	533307	533466	-	Intergenic	Y	novel-20
7	UUAUUUGAUCAAGGGAAAUUC	154	scaffold03802	905079	905143	+	3'UTR.1_Cassava 4.1_011822m.g	N	novel-21
8	UUUGGGGUAAAUUUGGACCAAA	46	scaffold05335	14983	15180	-	intron.4_Cassava 4.1_025731m.g	N	novel-24
9	UGGCCUUUUGAGUUUGAGAAGACA	100	scaffold05694	371116	371230	-	intron.6_Cassava 4.1_022022m.g	N	novel-27
10	UUGGAAGAGCUUACUUUAAAU	495	scaffold05875	2354583	2354832	-	Intergenic	N	novel-28
11	UCUGAAUCCCUGACGAAGCCU	243	scaffold05884	79762	79829	+	Intergenic	Y	novel-29
12	UUUAUAUCAUGCAUAAUUAAG	82	scaffold05890	126	236	-	Intergenic	N	novel-30
13	UGUCGCUGGAGAAAUGGCACUA	80	scaffold07240	11314	11420	-	Intergenic	nd	novel-38
14	UUUUAAUGAUAGUAUAGGGGU	12	scaffold07290	137355	137549	+	Intergenic	nd	novel-39
15	UGGGUGGGUGAGUGGAUAAGA	172	scaffold07996	160667	160818	-	Intergenic	Y	novel-40
16	UCCAGGCAAGGAAAGCUUUUC	28	scaffold08542	27109	27229	-	Intergenic	N	novel-44
17	UUGAGGGCUGUUUCCAGAAGC	207	scaffold10241	178034	178193	+	Intergenic	Y	novel-50
18	UCUAUAUGGUCUGCGGUUACC	219	scaffold12301	237927	238086	+	Intergenic	Y	novel-51-5p
18	UGACCGCAGACCAUAUAGAAC	446	scaffold12301	237927	238086	+	Intergenic	Y	novel-51
19	GGAAUGGGCGGUUUGGGAAAA	29917	scaffold04043	391309	391458	-	Intergenic	Y	novel-52
19	UUCCCAAUGUCGCCCAUUCCGA	890	scaffold04043	391309	391458	-	Intergenic	Y	novel-52-3p
20	AAAAGGAAGAUGGAGGGCAUGA	126	scaffold03264	387326	387485	-	Intergenic	nd	novel-53
21	ACUCUCCCUAAAGGCUUCAAC	3851	scaffold03581	762705	762813	-	Intergenic	Y	novel-54
22	UAUGGGGGGAUUGGGCAAAAU	38040	scaffold03604	533082	533222	-	intergenic	Y	novel-55-5p
22	UUCCCAAGACCUCCCAUACCAG	654	scaffold03604	533082	533222	-	intergenic	Y	novel-55-3p
No.	Mature_sequence	#. Read	WGS_ID	Start	End	Strd.	Genomic region		Name
(B) Ten novel miRNAs in castor bean
1	UGGGUGAGUGGAGAAGAUAAC	14	30128	2013705	2013875	-	intergenic		novel-40
2	GGAAUGGGCGGUUUGGGAAAG	3622	29586	144967	145126	-	intergenic		novel-52
3	ACUCUCUCUGAAGGCUUCAAA	4755	29742	519324	519418	-	intergenic		novel-54
4	UAUGGGGGGAUCGGGCAAUAUU	577	29660	174480	174647	+	intergenic		novel-55-5p
4	UCUUCCCGAGACCUCCCAUACC	281	29660	174480	174647	+	intergenic		novel-55-3p
5	UCUUAUAGCAAUCAGGGGACUUG	296	29877	66504	66639	+	intergenic		novel-63
6	UAGCAAAAGAUAGAACCGGAG	225	29904	1112560	1112809	+	intergenic		novel-64
7	UCUGAUAGCAAAAGAUAGAAC	528	29904	1112560	1112809	-	intergenic		novel-64as
8	CGAGUCAUCUGACAGAAGUAG	5102	29912	1877312	1877561	+	intergenic		novel-65
9	UGACGUGGCAUGAACUUCGGCA	756	30074	662171	662379	-	intron.6_30074.t000092		novel-66
10	UCCUCUGUCACAAAUGGCUUCCAG	182	29912	1868939	1869188	+	intergenic		novel-67

Included in (A) and (B) are the number of qualified reads from all small-RNA libraries (#. reads), the genomic scaffold ID (WGS_ID), the start and end positions of the hairpins, strand (strd.) and genomic region where a miRNA resides. Included also in (A) and (B) are mature miRNA sequences, named as miRn-5p and miRn-3p, if both sequences had a substantial number of reads. The “Y” or “N” indicates whether the novel miRNA has been detected or not, respectively, in at least one of four chilling treatment samples, and novel miRNAs not selected for validation are marked with “nd”.

Back to article page

ISSN: 1471-2164

Contact us

Submission enquiries: bmcgenomics@biomedcentral.com
General enquiries: ORSupport@springernature.com