Skip to main content

Table 1 Novel miRNAs in Cassava and castor bean identified from small-RNA profiling

From: Endogenous small-noncoding RNAs and their roles in chilling response and stress acclimation in Cassava

No. Mature_sequence #. Reads WGS_ID Start End Strd. Genomic region Validation Name
(A) Twenty-two novel miRNAs were identified and experimental validated in Cassava
1 UGGACGCCAUUUUGACAGAUG 248 scaffold00847 1153336 1153495 + Intergenic N novel-3
2 CAAAUUAUAAUGGCAUUUUGA 11 scaffold02022 100612 100777 + Intergenic nd novel-10
3 UGGGUAAGUGGGGAAGAUAAC 90 scaffold02264 510281 510416 + Intergenic N novel-11
4 AAAUGGGACUCAUCAUAUGGUGGG 50 scaffold02658 994069 994318 + intron.2_Cassava
4.1_019698m.g
Y novel-14
5 UGGCCUAGAGUAGUGACCUCC 346 scaffold02936 84627 84693 - Intergenic Y novel-16
6 AGAUGGGUGGCUCGGGAAGAAG 21209 scaffold03604 533307 533466 - Intergenic Y novel-20
7 UUAUUUGAUCAAGGGAAAUUC 154 scaffold03802 905079 905143 + 3'UTR.1_Cassava
4.1_011822m.g
N novel-21
8 UUUGGGGUAAAUUUGGACCAAA 46 scaffold05335 14983 15180 - intron.4_Cassava
4.1_025731m.g
N novel-24
9 UGGCCUUUUGAGUUUGAGAAGACA 100 scaffold05694 371116 371230 - intron.6_Cassava
4.1_022022m.g
N novel-27
10 UUGGAAGAGCUUACUUUAAAU 495 scaffold05875 2354583 2354832 - Intergenic N novel-28
11 UCUGAAUCCCUGACGAAGCCU 243 scaffold05884 79762 79829 + Intergenic Y novel-29
12 UUUAUAUCAUGCAUAAUUAAG 82 scaffold05890 126 236 - Intergenic N novel-30
13 UGUCGCUGGAGAAAUGGCACUA 80 scaffold07240 11314 11420 - Intergenic nd novel-38
14 UUUUAAUGAUAGUAUAGGGGU 12 scaffold07290 137355 137549 + Intergenic nd novel-39
15 UGGGUGGGUGAGUGGAUAAGA 172 scaffold07996 160667 160818 - Intergenic Y novel-40
16 UCCAGGCAAGGAAAGCUUUUC 28 scaffold08542 27109 27229 - Intergenic N novel-44
17 UUGAGGGCUGUUUCCAGAAGC 207 scaffold10241 178034 178193 + Intergenic Y novel-50
18 UCUAUAUGGUCUGCGGUUACC 219 scaffold12301 237927 238086 + Intergenic Y novel-51-5p
18 UGACCGCAGACCAUAUAGAAC 446 scaffold12301 237927 238086 + Intergenic Y novel-51
19 GGAAUGGGCGGUUUGGGAAAA 29917 scaffold04043 391309 391458 - Intergenic Y novel-52
19 UUCCCAAUGUCGCCCAUUCCGA 890 scaffold04043 391309 391458 - Intergenic Y novel-52-3p
20 AAAAGGAAGAUGGAGGGCAUGA 126 scaffold03264 387326 387485 - Intergenic nd novel-53
21 ACUCUCCCUAAAGGCUUCAAC 3851 scaffold03581 762705 762813 - Intergenic Y novel-54
22 UAUGGGGGGAUUGGGCAAAAU 38040 scaffold03604 533082 533222 - intergenic Y novel-55-5p
22 UUCCCAAGACCUCCCAUACCAG 654 scaffold03604 533082 533222 - intergenic Y novel-55-3p
No. Mature_sequence #. Read WGS_ID Start End Strd. Genomic region Name
(B) Ten novel miRNAs in castor bean
1 UGGGUGAGUGGAGAAGAUAAC 14 30128 2013705 2013875 - intergenic novel-40
2 GGAAUGGGCGGUUUGGGAAAG 3622 29586 144967 145126 - intergenic novel-52
3 ACUCUCUCUGAAGGCUUCAAA 4755 29742 519324 519418 - intergenic novel-54
4 UAUGGGGGGAUCGGGCAAUAUU 577 29660 174480 174647 + intergenic novel-55-5p
4 UCUUCCCGAGACCUCCCAUACC 281 29660 174480 174647 + intergenic novel-55-3p
5 UCUUAUAGCAAUCAGGGGACUUG 296 29877 66504 66639 + intergenic novel-63
6 UAGCAAAAGAUAGAACCGGAG 225 29904 1112560 1112809 + intergenic novel-64
7 UCUGAUAGCAAAAGAUAGAAC 528 29904 1112560 1112809 - intergenic novel-64as
8 CGAGUCAUCUGACAGAAGUAG 5102 29912 1877312 1877561 + intergenic novel-65
9 UGACGUGGCAUGAACUUCGGCA 756 30074 662171 662379 - intron.6_30074.t000092 novel-66
10 UCCUCUGUCACAAAUGGCUUCCAG 182 29912 1868939 1869188 + intergenic novel-67
  1. Included in (A) and (B) are the number of qualified reads from all small-RNA libraries (#. reads), the genomic scaffold ID (WGS_ID), the start and end positions of the hairpins, strand (strd.) and genomic region where a miRNA resides. Included also in (A) and (B) are mature miRNA sequences, named as miRn-5p and miRn-3p, if both sequences had a substantial number of reads. The “Y” or “N” indicates whether the novel miRNA has been detected or not, respectively, in at least one of four chilling treatment samples, and novel miRNAs not selected for validation are marked with “nd”.