Skip to main content

Table 11 Primer table

From: Analysis of qPCR reference gene stability determination methods and a practical approach for efficiency calculation on a turbot (Scophthalmus maximus) gonad dataset

Gene name Accession ID Primer F (5’ - > 3’) Primer R (5’ - > 3’) Product Length (bp)
RPS4 FE943956 CAACATCTTCGTCATCGGCAAGG ATTGAACCAGCCTCAGTGTTTAGC 143
RPL17 DQ848879 ACCAGTGCGTCCCCTTCA CTCATCTTCGGAGCCTTGTTC 214
GAPDH FE950888 CGCCCATAGCCCAGTCATAGC TGGCAGAGGGAGGTGGAGAG 167
ACTB EU686692 GTAGGTGATGAAGCCCAGAGCA CTGGGTCATCTTCTCCCTGT 204
UBQ FE946708 GCGTGGTGGCATCATTGAGC CTTCTTCTTGCGGCAGTTGACAG 124
B2M DQ848854 CTCTGGCTGTTTTCGTCTGCT TCCTTTCCGTTCTCTCCCG 86
CYP19a JQ403643 CAGCGAGGAAGCTGGCAAACA ACACGCAGACTCGGCTTTTTACATC 148
AMH JQ403642 CCAGGGCGGACCCCGATAAC TGGCTGTGTTTGGACCCACGAG 99
SOX9 JQ300535 ATCAGTACCCACACCTGCATAAC TCAGCCTCCTCCACGAACG 103
SOX19 JQ403639 ACCGAGCGGTTTGTGCCTTG TCCTCTGGATGCAGTGCTGATTGT 122
SOX17 JQ403638 TGTTCGGGAAGCAGGTGAAAGGT CTTGTTGCCATTTTAGGGGACAGT 92
VASA JX235364 CTTAGCTGTGGGCGTGGTGGG ACGTTCTCCTGGCACATCAACG 190
  1. Gene name, accession number, primer sequences and amplicon size of the reference genes (RPS4, RPL17, GAPDH, ACTB, UBQ, B2M) and the target genes (CYP19a, AMH, SOX9, SOX19, SOX17, VASA) are shown.