Skip to main content

Table 1 Information on 46 ABC transporters identified in the T. japonicus genome

From: Genome-wide identification of whole ATP-binding cassette (ABC) transporters in the intertidal copepod Tigriopus japonicus

Gene Length (AA)   Accession no. Matched gene Matched species E-value Real-time RT-PCR primer (5′ → 3′)
ABCA1 2428 KF906264 ABCA1 (XP003747270) Metaseiulus occidentalis 0 F: CGGCAGGTCTTATGAGTTTC R: CATTGTAAGTTTGGATTTGGG
ABCA3 isoform X1 1541 KF906265 ABCA3 (EKC30762) Crassostrea gigas 0 F: TGATTCTGTGCCCTACTACTTG R: GAGATGGGTGATTGGTGAAG
ABCA3 isoform X2 1808 KF906266 ABCA3 (XP001851801) Culex quinquefasciatus 0 F: TAGTTATGACACGGAGGTTGC R: TGAATAGTTGGTATGAACAGGG
ABCA5 1781 KF906267 ABCA5 (XP001607492) Nasonia vitripennis 0 F: GACAGCAATCAGATGGAGGA R: CTTTCTTCCATTCCTCTGATTC
ABCA13 3124 KF906268 ABCA13 (EFN62269) Camponotus floridanus 0 F: AGGTTTGTCTGAGGATGCTG R: GTATTTTGGGTCAATGTGCC
ABCB1 (Full transporter) 1361 KF906269 ABCB1 (AFS49708) Tigriopus japonicus 0 F: GTGATGATTATTCTCTTTGGTGAC R: ATTGATTGCTGGAGTGTCGT
ABCB6 (Half transporter) 827 KF906270 ABCB6 (XP003485185) Bombus impatiens 0 F: CCTTATCAAATGCTTGGGTC R: AGAATCCAAGTTGAATACACCC
ABCB7 (Half transporter) 692 KF906271 ABCB7 (XP001813375) Tribolium castaneum 0 F: AGCCTAAAGTCCAGAATAAAGTG R: CAAACTGAGTCCGTTCAAGATA
ABCB8 (Half transporter) 676 KF906272 ABCB8 (EKC24099) Crassostrea gigas 0 F: TTATTCAAGGCTTTCCAGACA R: GAATGGTCGGATTTTTGAGTA
ABCB10 (Half transporter) 665 KF906273 ABCB10 (XP005102782) Aplysia californica 0 F: ACTTCGGCAGGATTTATTTG R: GTTGCGTGTCTGATGAAAGTC
ABCC1 isoform X1 1493 KF906274 ABCC1 (XP003243122) Acyrthosiphon pisum 0 F : ACGGGAAGTATCATCAATCG R: GATGACAATGAGGACGGATG
ABCC1 isoform X2 1515 KF906275 ABCC1 (XP001604021) Nasonia vitripennis 0 F: TTATCCTTCCAGTTATTGACCTT R: AGCAGAGAGCACACACATAGG
ABCC1 isoform X3 1497 KF906276 ABCC1 (XP003426122) Nasonia vitripennis 0 F: TCATACTCAGTTACTATCCTCTT R: AAGGTCAGCAAGGATGGATA
ABCC1 isoform X4 1513 KF906277 ABCC1 (XP005176239) Musca domestica 0 F: GGGGAAACTGTGAATCTTATGT R: TAGGAAAGCCAAGGACAAGA
ABCC1 isoform X5 1509 KF906278 ABCC1 (XP001604021) Nasonia vitripennis 0 F: GTGTCAATCGTAACATTCCGT R: GTTTTCACGAAGAGGAGGATT
ABCC1 isoform X6 1476 KF906279 ABCC1 (XP003243122) Acyrthosiphon pisum 0 F: CAGTGCCACAGTTTCTACCAT R: ACAACTTCAGACTCTTCCGATAG
ABCC1 isoform X7 1533 KF906280 ABCC1 (XP001604021) Nasonia vitripennis 0 F: TGATGAAGAGGCTATGATTGG R: AGAGGAGAAACGAGATAACGC
ABCC1 isoform X8 1436 KF906281 ABCC1 (XP006119649) Pelodiscus sinensis 0 F: TCAAGAACAAGGACGAGAGG R: CTTCAATGTTTCGGTATCCC
ABCC1 isoform X9 1611 KF906282 ABCC1 (XP003426121) Nasonia vitripennis 0 F: TCTCTTGGTTTACGGGTTTG R: GAAACACGAAGCGACTCATC
ABCC1 isoform X10 1523 KF906283 ABCC1 (XP001604021) Nasonia vitripennis 0 F: CAACGAGAGTCCAAACGAAC R: GGAAACAAGTGGTGAAATCG
ABCC2 isoform X1 1346 KF906285 ABCC1 (XP004770550) Mustela putorius furo 7E-116 F: AGTATTCTCTCTCCGCATTCTC R: TGCCAATAAGGAGAGTGTAATG
ABCC2 isoform X2 1380 KF906286 ABCC1 (XP004580304) Ochotona princeps 0 F: ATTAGCCAGTAAGAAGTTGAAGG R: GTCGTTCCCAAACATTCATC
ABCC4 1386 KF906287 ABCC4 (XP002939329) Xenopus tropicalis 0 F: AGTATTCCTAAGTTGGTTTGTGG R: ACGGATGATGAGTGAAGGTG
ABCC5 1422 KF906288 ABCC5 (XP005051248) Ficedula albicollis 0 F: TCAACAACCCTACACTTCCTG R: GCAGACAAGAGCGATGATTT
ABCC7 1496 KF906289 ABCC7 (ELT97351) Acromyrmex echinatior 0 F: CAAATGACCCTCAACGAACT R: AGATACCGATGGAGAAAAACC
ABCC9 1949 KF906290 ABCC9 (XP003698789) Apis florea 4E-135 F: TTGGGTCTGTTATCATTCTGG R: ACGAGTTGAAGCAAGGTGAG
ABCC-like 1296 KF906284 ABCC1 (XP001341895) Danio rerio 0 F: GAAAAACGATAAGGCTGGTG R: CTATCCCAACTTTCTGACCG
ABCD2 736 KF906291 ABCD2 (XP001943381) Acyrthosiphon pisum 0 F: GATGACGAAGAGACGACAATG R: GTCGTTGAAGCCTTTCTATGA
ABCD4 isoform X1 603 KF906292 ABCD4 (XP004699087) Echinops telfairi 4E-153 F: AATGGAACTGGTCTGATGTGA R: ACAAGGACAAGGCTGAAGTG
ABCD4 isoform X2 608 KF906293 ABCD4 (XP005021486) Anas platyrhynchos 7E-169 F: ATCAGTTACTACACCTATTCGGC R: CACGGGCGACATAAGTAGTT
ABCE1 611 KF906294 ABCE1 (XP003690922) Apis florea 0 F: ACGAACCCTCTGCTTATTTG R: GCTCCACGATAAAACCTGTC
ABCF1 820 KF906295 ABCF1 (XP004531105) Ceratitis capitata 0 F: CGAGAGTGAAGATGAAGACCA R: ATTTCTTGCCTTTCTTGTCCT
ABCF2 642 KF906296 ABCF2 (XP003403104) Bombus impatiens 0 F: GATTTGGAGGCTTGTGTCTG R: TCCAGATGAATGATGTTGCTAC
ABCF3 711 KF906297 ABCF3 (XP004923267) Bombyx mori 0 F: AATGTTGCTCAAGAAGATGGA R: GGCTTTGGCATCTTTTTTAC
ABCG_125057 687 KF906298 ABCG (XP003489743) Bombus impatiens 0 F: TTATCGGCACACTCACTCCT R: ACACTATCCACACGAGCCAT
ABCG_90506 659 KF906299 ABCG (EFX83517) Daphnia pulex 0 F: GGAAACGGTAATGAATCTGG R: GGATTCTTGATAACAGATAACCAG
ABCG_75152 651 KF906300 ABCG (XP_003398687) Bombus terrestris 0 F: GTTACTAAAGAACCTCTCATTGC R: CCTTCTTGATTATTTTCTTGTCC
ABCG_105304 656 KF906301 ABCG (NP001034521) Tribolium castaneum 0 F: ATGTATTCACACGGGAGACG R: TACACAGCACGACAAATCCA
ABCG1 767 KF906302 ABCG1 (EGI70628) Acromyrmex echinatior 0 F: TGAGACAAACTTGAAAGAGAAAC R: ACACCTTCGGAGTTGTATGC
ABCG5 isoform X1 656 KF906303 ABCG5 (XP003748075) Metaseiulus occidentalis 1E-170 F: ATTACCAACATCTCTCAAACACC R: TCCACTTAGCGACCTCCTTA
ABCG5 isoform X2 822 KF906304 ABCG5 (XP003694147) Apis florea 2E-141 F: CTATCCATCCACCAACTTACG R: CAAGGATAGTCAATGAAGGCA
ABCH_139282 768 KF906305 ABCH (EFX78467) Daphnia pulex 0 F: TGAGAAAGTTGCCTCTGGTC R: GATGGCTTGAATGCTGTAGTC
ABCH_88708 788 KF906306 ABCH (EFX78468) Daphnia pulex 0 F: CAAACACAGCCATCTCCTTC R: GTAGATGGCACCTTTTGGAA
ABCH_103004 778 KF906307 ABCH (EFX78468) Daphnia pulex 0 F: GTTGTGTTTGGTGTTCCTCC R: TTGAGTGGCATCTTGTTGAGT
ABCH_55580 723 KF906308 ABCH (EFX78468) Daphnia pulex 0 F: ATCTATCAACTGCCCACTGC R: TTCCCATCTCCTCAGTGTTG
ABCH_68644 714 KF906309 ABCH (EFX71377) Daphnia pulex 4E-88 F: TCCTCGGTTATTGATTCTCG R: CAAATAGTGTGTGGTGATGAGG