Skip to main content

Table 6 Real-time PCR primer pairs for the expression analyses of PAL , CHS , F3H , and IFS genes

From: Expression quantitative trait loci infer the regulation of isoflavone accumulation in soybean (Glycine max L. Merr.) seed

Gene Forward primer (5′-3′) Reverse primer (5′-3′) PCR product length (bp)
Actin4 GTGTCAGCCATACTGTCCCCATTT GTTTCAAGCTCTTGCTCGTAATCA 214
PAL ATTATGGATTCAAGGGAGCT AATGAGGAAAGTGGAGGACA 182
CHS AAAATGCCATCTCCTCAAACA GGATCTCAGCTACGCTCACC 155
F3H GCTTGCGAGAATTGGGGTAT CCTTGGAGATGGCTGGAGAC 176
IFS GCCCTGGAGTCAATCTGG CAAGACTATGTGCCCTTGGA 171