Skip to main content

Table 2 Sequences and conditions for new primers used in SYBR Green real-time RT-PCR assays

From: Metabolic consequences of microRNA-122 inhibition in rainbow trout, Oncorhynchus mykiss

Gene Forward primer (5′3′) Reverse primer (3′5′) Tm (°C) Gene bank or SIGENAE accession number Amplicon size (bp)
omy-miRNA-122 TGGAGTGTGACAATGGTGTTTGT Poly T Primer (Invitrogen) 60 - -
cyp2k5 CTCACACCACCAGCCAAGAC CGTCAGCAGAGGTAACACATCAG 60 NM_001124742 76
ptgr1 CAGTGATTGTGGATGGAGGAG CCTTGATCTTGGCGATCTGT 60 NM_001124634 238
arcn1 AGCCTCACTTGTGGGAGAGA CTTGTCACCGTTGTTGATGG 60 NM_001164069 119
Gs AAGATATGGAGGCGGAGAGG GATCTCAAGGACCAGGGTTG 60 BX299627.p.om.8 152
Pygl AACCGACACCTCCACTTCACC CCTGCATCTTCCTCCATCTC 60 BX882218.p.om.8 296
srebp2 TAGGCCCCAAAGGGATAAG TCAGACACGACGAGCACAA 60 BX859204.p.om.8 161
Hmgcs AGTGGCAAAGAGAGGGTGTG TTCTGGTTGGAGACGAGGAG 60 CX251971.p.om.8 298
Hmgcr GAACGGTGAATGTGCTGTGT GACCATTTGGGAGCTTGTGT 60 AB218825.p.om.8 216
dhcr7 GTAACCCACCAGACCCAAGA CCTCTCCTATGCAGCCAAAC 60 CA376644.p.om.8 289
cyp7a ACGTCCGAGTGGCTAAAGAG GGTCAAAGTGGAGCATCTGG 60 AB675933 111
cyp7b ACAGAGACCTCACCTTCACCA GATCTCCCTTCCTCACTCCA 60 F6VG15V01BFI5C.p.om.8 171
abcg5 CACCGACATGGAGACAGAAA GACAGATGGAAGGGGATGAA 60 CU073172.p.om.8 268
abcg8 GATACCAGGGTTCCAGAGCA CCAGAAACAGAGGGACCAGA 60 FYV3OTN01BVHON.p.om.8 159
utg1a3 CCACCAGCAAGACAGTCTCA CAACAGCACAGTGGCTGACT 60 F6VG15V01BF6CZ.p.om.8 216
  1. Gene bank accession number (http://www.ncbi.nlm.nih.gov/genbank) are provided when available. For the remaining sequences, accession numbers from the trout EST database SIGENAE (http://www.sigenae.org) are provided. Additional primer sequences have been previously published and can be found in sources cited in the text.