Skip to main content

Table 6 Primers used in quantitative real-time PCR

From: Genome-wide transcriptome analysis of genes involved in flavonoid biosynthesis between red and white strains of Magnolia sprengeri pamp

Gene ID Primer sequence(forward) 5′-3′ Primer sequence(reverse) 5′-3′
55739 TAACGAAGCCGAAACAGGA GAGAATTGGGCGAACATCA
53876 ACGCATCTTACGCCAGTG ATTCCAGCCGTTCATTCT
43573 TCGTGGAAGCGTGCGAGGAC AGCGTGATGGTGCCAGGGTC
47103 CGGTTCGTGGCTGGTTAT TCCGCTAGTGATTTGGAGAC
49650 GCAGAAACAATCCATCCCTCAA CAGGACGACAGTAAACAAGGAGAA
50438 GCAGGCATCCAAGCAATAC AATAATCCTCCCACTCAAGC
51086 GGGGACTCTACACCAGGAA CTAACGGAGGAGATATTGACG
25552 GCCTCACATAACCTTTCTC TTGACCCTTTCAGCCAGTA
45264 CAATCGGTGTCGTAAGAGC CCCGTCGTAATGGAAAGTA
45298 TTTATTTAGTGCCGATACCA ATTACGATGTGCCAGGAG
46821 GCGAATCATACTCCGACAT TTGCTGCTTTGACTCTGC
47225 ATGCGTAGGTAGATGGTTG CACTGATACTGAGGAGGAGAA
47747 CCGAAGAAGATGCGACAAA GAGCAGCGATTCAAGAGCC
50161 GGCTTGATTTGGGAGACGA TACCGACCTGTGGCGAGAA
53953(Actin) GGCTGGATTTGCTGGAGAC GTGGTGCTTCGGTGAGGAG
\