Skip to main content

Table 1 Primer sequences used for this study

From: The I2 resistance gene homologues in Solanum have complex evolutionary patterns and are targeted by miRNAs

Marker Sequences 5′to 3′ Note
M-73000 F:ATTCCCACCCTTGATGATGT Screening recombinant individuals
R:TTCTTTAGCCAACTCCTTGC Restriction enzyme: Taq I
M-137 F:TAGCTTGGGATCGACATCTT Screening recombinant individuals
R:CTCGTTCTCGCATTCATTTA Restriction enzyme: Mbo I
I2 F:TGTGCTAAGTGAYGCASAGA Amplification of I2 homologs
R:TAGAGAGGGRAGRGCA
T-I2-1 F:GCTTGAATTTAGAGATATGCG Mapping I2 homologs
R:GCTTAGGGCAATAGAAGATAGT
T-I2-5 F:CCCTTCTACAAATTGGAGCACA Mapping I2 homologs
R:GGTAGTTTGCAGTATGCTAACA
T-I2-8 F:ACCACTGACTGTTACTTTCTAT R:ATTAGGGCAATGGTAGATCAC Mapping I2 homologs
T-I2-2 F:TTCTCCTGTCATCTTGTTGTTC Mapping I2 homologs
R:CCAAGTAACGTTCTGGCAATTT
T-I2-3 F:GGCTTAATGGGCTTCGAGTC R:GTTCCACAAGTGACGGTAT Mapping I2 homologs
T-I2-6 F:AGATTGAAAGCATTAAATATCA Mapping I2 homologs
R:ATTGGATACCTCAAGTCTTGT
T-I2-7 F:GTGGCTTAATGAGCTTCGAGA Mapping I2 homologs
R:TCACATTCTACCACTTTCAAG
T-I2-9 F:CCAATCCAGTTCACTCTTTCA Mapping I2 homologs
R:ACCAGTTTCTTGCAATCATA
T-I2-10 F:GTCCCAAATCCTTCAGAG Mapping I2 homologs
R:CAAAGATTTTCAGGCAACTTT
Race-P1 R: GGAAGATCATTGTAGCTCAACATYA Identification of miRNAs’ cleavage sites
Race-P2 R: CGTGTMGTCACAATGATCTTACTTCC Identification of miRNAs’ cleavage sites
Race-P3 R: TTTCCTTCAATTTGACTTGWAGC Identification of miRNAs’ cleavage sites
  1. The usage of primers is listed in ‘Note’ column. Restriction enzyme indicates the marker is a CAPS marker.