Skip to main content

Table 3 New miRNAs identified

From: Genome-wide identification of microRNA and siRNA responsive to endophytic beneficial diazotrophic bacteria in maize

miRNA ID Length of hairpin precursor MFE MFEIa Randfold p-value Sequence sRNA length RPM - CT RPM - Hs
Zma_miR_Seq01 169 -42.5 0.61 0.029703 AAAATTTAGAGGACGTTGCTGGAG 24 - 10.34
Zma_miR_Seq02 141 -84.8 1.15 0.009901 AAACCGTCGGAGATAGCTTATGTC 24 - 8.86
Zma_miR_Seq03 128 -76.7 1.08 0.009901 AACCTATGTCCGACGGTTTTAGGC 24 - 7.39
Zma_miR_Seq04 79 -26.4 0.52 0.09901 ACGTCTATGGTTAGATCACGCGGC 24 - 8.86
Zma_miR_Seq05 75 -23.9 0.70 0.049505 ATAACTGTAGTGCATTAAAGCGGG 24 4.07 7.39
Zma_miR_Seq06 173 -60.52 0.85 0.009901 ATCCATATGGACTGGGAGGAAAGC 24 - 44.32
Zma_miR_Seq07a 104 -58.3 0.80 0.009901 CCCGCCGGCGAGCGCTTTCCT 21 - 13.30
Zma_miR_Seq07b 104 -58.3 0.80 0.019802 CCCGCCGGCGAGCGCTTTCCT 21 - 13.30
Zma_miR_Seq08 170 -91.5 0.92 0.009901 CGGCGGGGGCGAACTGAGAAC 21 21.70 143.31
Zma_miR_Seq09a 161 -64.2 0.84 0.009901 CGTGGTATTGTTTCGGCTCATG 22 11.53 125.58
Zma_miR_Seq09b 123 -57.4 0.94 0.009901 CGTGGTATTGTTTCGGCTCATG 22 11.53 125.58
Zma_miR_Seq09c 123 -57.4 0.94 0.009901 CGTGGTATTGTTTCGGCTCATG 22 11.53 125.58
Zma_miR_Seq10 114 -31.3 0.68 0.059406 TCCTTGTTGGACAGATAAAGGAGC 24 - 7.39
Zma_miR_Seq11 85 -45.5 1.17 0.009901 TTGTTGGTCTATTCGGGTTTTCGA 24 - 7.39
Zma_miR_Seq12 143 -57.8 0.81 0.009901 CATGAACCGAGCGAGCTAGCGAGC 24 14.92 -
Zma_miR_Seq13 232 -110.7 0.75 0.009901 GGCGGACTGGGAACACATGGG 21 7.46 -
Zma_miR_Seq14 152 -103.3 1.45 0.009901 TTGGGAGCCACAAAACTGAAG 21 3.39 -
Zma_miR_Seq15 179 -84 1.00 0.009901 TTTTGTTGGTGGTCATTTAACC 22 14.24 -
  1. aminimal folding free energy index (MFEI) was calculated according to Zhang et al. [99].
  2. CT: control library, Hs: Inoculated library, RPM: reads per million, MFE: Minimum Free Energy.