Skip to main content

Table 1 Primers for gene expression validation with qPCR and amh PCR and sequence analysis

From: Identification of male-specific amh duplication, sexually differentially expressed genes and microRNAs at early embryonic development of Nile tilapia (Oreochromis niloticus)

Gene symbol/probe Description Accession number Forward and reverse primers (from 5’ to 3’)
tspan8 tetraspanin-8 XM_003448079 TGTATGTTGTGGAATAGGCATCA
    GGTGATTTGTAAAGCTGTTTCG
fcgrt major histocompatibility complex class I-related gene protein-like ENSONIG00000008406 TGGTGTGAGCAAGGACTTCAT
    ACATGAACCAAAGGACTGTAAACT
cr/20β-hsd carbonyl reductase-like 20 beta-hydroxysteroid dehydrogenase XM_005473633 CCAAAATTGTTCGTTTTATTCTCG
    TTTCATTTTGATGCGTTCCA
gpa33 cell surface A33 antigen XM_005466820 AATGTCCAAAAGCCAACCTAAA
    TACTACATCTGCACCTCGGAGA
rtn4Ip11 reticulon-4-interacting protein 1 homolog, mitochondrial XM_003459954 GCATGTCAAGGCATCAAATAAA
    CCTCTGCTGGTTGTAAATGTGA
26098 hypothetical protein   TTCCTGAAGACAGTACAGTACAAAA
    CGAATTCTTCTGGTCAAGTTCTTC
zp3 zona pellucida sperm-binding protein 3 receptor-like XM_005448435 TGTCTGTAACTACTCATTTGGATCA
    CCATTTTACAGATCCAACTTTCC
gapdh glyceraldehyde-3-phosphate dehydrogenase XM_003452690 GGCATCGTGGAAGGTCTCAT
    CATTTTACCAGAGGGCCCGT
rpp30 ribonuclease P protein subunit p30 XM_005471600 CCCGACTCCTATCAACGAAC
    AAAGTGACTCGCGTCTGACA
amh anti-Müllerian hormone1 DQ257619.1 TTCTTATCGCTCCGACTTCTTC
   TAGGGCTGGTTGATATGGAATC
anti-Müllerian hormone - exon VII2 XM_003451305 AGCAGCTCTAGCGGCATCCACA
   TGTGTTTTCTTTCTGCGTCCGCCA
13: 5’ UTR, exon I, intron 1, exon II ENSONIG00000004781 AGAGGAGTCATCAGTCCAAAGC
   AGATGTCCTCCACGAAGCAT
2: exon II, intron II, exon III ENSONIG00000004781 AAGACCCCATCATCACCATC
   TTGTCTGAGCCGTAATCTGC
3: exon IV, intron III, exon V, intron IV, exon VI ENSONIG00000004781 GGAAAATCATCAGAGGGGAGT
   CTGCCGACTTCAGAACTTTT
4: intron VI, exon VII, 3’ UTR ENSONIG00000004781 CGGTCCCAGTGACCTATGAG
   AAGTACACGTGGTGTATTGTAATTGA
5: 3’ UTR ENSONIG00000004781 CCCCAGCATTTATAACTTTCACA
   CCTGCCTCAAGTATGCCTTT
LM4: intron VI, exon VII ENSONIG00000004781 TGTGTTTTCTTTCTGCGTCCGCCA
    AGCAGCTCTAGCGGCATCCACA
  1. 1qPCR validation of microarray.
  2. 2PCR of cDNA.
  3. 3set of 5 primer pairs for sequencing.
  4. 4Linkage mapping.