Table 1 Gene names, accession numbers from wfleabase.org (for D. pulex and D. magna ) and primer sequences used in qPCR analyses
From: Deciphering the genetic basis of microcystin tolerance
Gene | D.pulex | D. magna | Primer forward (5′-3′) | Primer reverse (5′-3′) |
|---|---|---|---|---|
transporter of the ABC superfamily | DappuDraft_99518 | m8AUGep24bs03373g21t1_ext | TCTCGGGTGGTGAAAGGAAA | ATGCCTGGACGATGTTCTGA |
multidrug/pheromone exporter | DappuDraft_127589 | m8AUGapi5_contig28666g180t1 | CGCCATACCAATGTTCGCTT | CTGCCTGCCCAATCATTTGT |
permease of the major facilitator superfamily | DappuDraft_303762 | m8AUGep24bs00868g315t1_ext | CGGTTCGACTATAACGCTGC | TTCTTTGCCAGGCTTGACAC |