Skip to main content

Table 2 Primers and other DNA sequences used in this study

From: Unlocking the mystery of the hard-to-sequence phage genome: PaP1 methylome and bacterial immunity

Primers or other DNA sequencesa Sequence (5′-3′) Target genes or locations
Construction of the nfi mutant
Cm-F GTGTAGGCTGGAGCTGCTTC Chloromycetin-resistant gene of pKD3
Cm-R CATATGAATATCCTCCTTAG  
Nfi-F TGTGCCGCCAGAACATGC nfi gene of E. coli DH5α
Nfi-R GACGCAGATGAATTGGGT  
H1 CGTGGAGGCAGTGCATCGACTGTCTGAACAGTATCACCGCTAAGGAGTGATTATG Upstream of the nfi gene
H2 TTTGTAACATGTTGAGTTCTCAAATACGGAAATTATCCGCAGTTTACCTGAATTA Downstream of the nfi gene
  1. aPrimers and other DNA sequences were synthesised by BGI-Shenzhen (Shenzhen, China).