Skip to main content

Table 1 Bacteria, phages, plasmids and primers used in this study

From: Methyltransferases acquired by lactococcal 936-type phage provide protection against restriction endonuclease activity

Bacteria Features Source
L. lactis NZ9000 Host strain for expression [53]
L. lactis SM M Host strain for Phi93 [23]
L. lactis SM E Host strain for Phi145 [23]
L. lactis SM 13 Host strain for Phi15 [23]
L. lactis SM 11 2nd propagating strain for Phi15 [23]
E. coli EC101_pPTPi Strain carrying low-copy plasmid pPTPi [23]
E. coli EC101 Host strain for cloning [54]
E. coli K12 Competent, DAM-/DCM- Strain for pPiM.93DAM cloning NEB
Phage Features Source
Phi15 Methylase positivea [23]
Phi93 Methylase positive [23]
Phi145 Methylase positive [23]
Plasmids Features Source
pPTPi Tetracycline resistant, Nisin inducible, bTetr [52]
pPiM.93DAM pPTPi derivative encoding mtPhi93-DAM, bTetr This study
pPiM.145I pPTPi derivative encoding mtPhi145-1, bTetr This study
pPiM.145II pPTPi derivative encoding mtPhi145-2, bTetr This study
Primers Sequence (5'-3') c Source
93DAMMTaseF agcagcGGATCCAGGAGGCACTCACATGCACCATCATCATCATCATTCTTCTGGTAATAATGAATTAATG This study
93DAMMTaseR gctgctCCCGGGTTAATGATGATGATGATGGTGACCAGAAGTTCAAATATCACGACCATG This study
Phi145.M1F agcagcGGATCCaggaggcactcacATGCACCATCATCATCATCATTCTTCTGGTATTGAATTAAATAAA This study
Phi145.M1R agcagcCCCGGGTTACTATTCGTTTTCAGATAT This study
Phi145.M2F agcagcGGATCCaggaggcactcacATGCACCATCATCATCATCATTCTTCTGGTCTTAAGTTAGACGAG This study
Phi145.M2R agcagcCCCGGGTTAACTGTTTTTAACCATAAA  
mcsPTPiFwd CTGAGGTTCTTATGGCTC [51]
mcsPTPiRev TTCGCTTTTAAAGTCGATTTCAT [51]
  1. aPredicted from BlastP and REBASE.
  2. bTetr?=?Tetracycline resistant.
  3. cRestriction sites incorporated into oligonucleotide primer sequences are indicated in bold.