Skip to main content

Table 2 Evaluation of differences by PCR and Sanger sequencing

From: Complete genome determination and analysis of Acholeplasma oculi strain 19L, highlighting the loss of basic genetic features in the Acholeplasmataceae

Primer Sequence 5′- 3′ No. of differences Position of the conflict SMRT SBS Sanger
Aocu1FS1 ACGCAATTTTGAATGCGAGTC 1 29,164 A G G
Aocu1RS1 AAGCGCCACCCATCTTTACA
Aocu2FS2 TCCAAGATCAACCGTTGGAACA 1 45,841 C T T
Aocu2RS2 TCTTTGTGCCTCACCACCTG
Aocu3FS3 GGCAGTTGGTACAAGAGCGA 1 94,414 A C C
Aocu3RS3 AAATTCCGGTGGTGGTACGG
Aocu45FS4 ACAGTTGATGGAAGCTATGAAGG 2 227,147 A C C
Aocu45RS4 ACGGTTGTTGGGAATCATGG 228,403 A G G
Aocu6FD5 ACTGCAGCTAATCCAACGGA 1 332,224/5 G - -
Aocu6RD5 TTCAAGTGTTCCACGTCGGT
Aocu7FS6 TCAGCATCCGGTTATGCTCC 1 460,047 G A A
Aocu7RS6 GTTGGATGCCACTCGAAGGA
Aocu8FS7 TCTTGTCTTGACCACCCCAA 1 584,955 A G G
Aocu8RS7 CAGCAAGTGTTTGACTCGCA
Aocu910FS8 AAATCAGTTGCTGCATTAAGAGGT 2 904,938 G C S*
Aocu910RS8 ACTGGGAGTATCGATTGCAGG 904,961 C A M*
Aocu11FS9 TTAGATAGTGCGGCAAGGGG 1 927,019 G A R*
Aocu11RS9 AACGCACCGAATCATTTCGC
Aocu12-FDI10 GTCGATGCGCAAGCATAACC 4 972,742/3 T - -
Aocu12-RDI10 TCTAGGAGGAACACCATCACG 974,678/9 -- AG AG
   974,999/975,000 -- CT CT
   975,166/7 -- AG AG
Aocu16-22FDI11 TGCTAGCTGACCTTATGGGAC 7 976,093/4 T - -
Aocu16-22RDI11 GACGTTTAGGCGAAGTAGTCG 976,419 - A A
   976,451/2 T - -
   976,520/1 G - -
   976,525 - T T
   976,634/5 T - -
   977,480 - T T
Aocu23FS12 GCAATACGACCAACCAAGCG 1 1,091,760 T C Y*
Aocu23RS12 AATGCGCCAATTCCAAAACG
Aocu24FS13 GACCAACGTTTCTCGCATGG 1 1,410,995 A G G
Aocu24RS13 TGACCACTTAGGTAATCGTCGT
Aocu25FS14 AACTTGGTCCATGTGCCTCT 1 1,443,728 A G G
Aocu25RS14 ATGAGGCTACCATTACCCGC
Aocu26FS15 ACCTCGATTGTTCCACCAGC 1 1,471,015 C T Y*
Aocu26RS15 AAGTGCTCGCTTACGTCTGG
Aocu278FSI16 TTGCTTGGTTAGCTCCTCCC 2 1,576,028 T A W*
Aocu278RSI16 TAGGTGTGCGTCCTGAAGGT 1,577,778 - T T
  1. Sixteen primer pairs were designed for the PCR and Sanger sequencing of 28 different regions resulting from the SMRT (PacBio) and SBS (Illumina) approaches. Primer pairs, numbers of identified differences, positions in the submitted sequence, SMRT- and SBS-determined sequences in any particular position are provided in addition to the Sanger sequencing results derived from the PCR product. Ambiguous results obtained by Sanger sequencing (*) were interpreted from the sequencing chromatograms.