Skip to main content

Table 4 qRT-PCR primer sequence list

From: Identification of miRNAs involved in pear fruit development and quality

miRNA name Forward primer sequence*
miR166a TCGGACCAGGCTTCATTCCCC
miR4376-5p ACGCAGGAGAGATGACGCCGA
miR156k TTGACAGAAGAGAGTGAGCAC
miR396b-3p TTCCACAGCTTTCTTGAACTG
miR164c* TGGAGAAGCAGGGCACGTGCA
miR159b-3p TGGATTGAAGGGAGCTCTACA
pear-5S GAAAGATGCCAATTCATGCG
  1. Note: *Reverse primers are universal reverse primers for miRNA.