Skip to main content

Table 2 Primers used for qRT-PCR analysis

From: De-novo assembly of mango fruit peel transcriptome reveals mechanisms of mango response to hot water treatment

Gene Forward 5‘ → 3’ Reverse 5‘ → 3’
Actin CATTGTGCTCAGTGGTGGTT TTGGAGCAAGTGCAGTGATT
FSL TGGGAGCATATGTTAGGGTATTGG TCTCATCGCCTCATAATTCAAGAA
PAL AATGGAAATGCGGCGATTC TCCCAGCTCTTCCCTCACAA
CHS GAAAGATGTTCCCGGGTTGA AGTCGTTGATGCCGATTGG
CFIL GCAGTGATCCCACCACTTGA TCATGCATTCGTACATCTGTAGCA
Oxybp CAATTCGACGGAACCGAATC CCGTTCCCTACCAAGTCGTTT
IT1K2 AACTATTTCCCTGGGTATGGGAA CTGACTCTGTTTCAGGCCCAA
Chitinase 7 CATTCAAGACTGCCCTGTGGTA GGCTCGAATAGTTGCACCAAA
Hl1ch TGCAACACCAAAGCAACAAAC TCCCACCATCTAAGAGACCTACTG
PIRCS AGTCTAACGCTGACAGGAAGGAA AATCCACCAGCGAACTTGGA
LHCIIb GGGCTATGCTTGCTGTTCCA AGCCCACTCTTGAGCCTTTACC
85A2 CAAGCTTCATGAGAGTCACTGATG GAAGATTTCAAGCAGTCGTGTGAT
Entkox TGGCAGTGAGATTGCCGTAA CAGGCCTCCACACGTTAGGAT
Salometh ACTCACCATCACCAAGCGAAA TTGTGTAATCTCAGTCCGATCAATC
Syn121 TGCGGTCCAGGATCTTCATC TCCATCGAGTCCTGCAACTTC
Glutaredoxin GGGAAGATGGTTTCCGAGAAT AGCAAACGCTTCACCACATG
AOS AGAGCAGAGGAGTTCGTGGC TGGTCCGTTTGACCACAGC
Peroxidase15 TGCCCAGGAGTTGTCTCTTGT CAGGTTTGACCTCCATCCAAA
Ugft3 CTCATCTGCAATCCAGAAATCG AATCGAGTGTCGCGGTTTG
Thl1ch TGCAACACCAAAGCAACAAAC TCCCACCATCTAAGAGACCTACTG
Oxepch GCCACGTCTCGAACATTAAGC TACACTGCCGTCGTCTTCTTGA
Anthocyanin5 TTTCTCACTTCCCTGCTTTGG TCCGGCGTCATTACAGATGA