Skip to main content

Table 1 Genes targeted and primers used for quantification of bovine and A. phagocytophilum DNA

From: Comparative genomics of first available bovine Anaplasma phagocytophilum genome obtained with targeted sequence capture

Organism Gene targeted Primer Sequences 5' - > 3' Amplicon size (bp) Reference
A. phagocytophilum ankA F: CTATCATCCTTGGGTAGTGGCCT 223 This study
R: CTTCTGGTGTTCTCGGACCTTC
gltA F: ATATCTACCGGAACCCCCATAGC 209
R: AAAAGCTATGACCCTAGAGCGCGT
groEL F: GTGATTCGCACGCTCTTAGCAGT 172
R: GCCTTCAAGTTGCTGCTGTAAA
Bos taurus gapdh F: TTCACACTCTCCTTCCAGGTACG 217 [30]
R: TCAGGGCCTTAGAGATGGAAA
ywhaz F: TACTCCGGACACAGGTAAGGGAC 212
R: AGAACCCAGCGGAAGAGAAG
ppia F: CTGTTCTAGGTTGGATGGCAAGC 137
   R: TTTGTCCACAGTCAGCAATGGTGA