Skip to main content

Table 5 Sequence of TRAV/TRDV subgroup-specific primers

From: Genomic analysis offers insights into the evolution of the bovine TRA/TRD locus

TRAV/TRDV subgroup Subgroup-specific 5′ primer sequence
AV1 CAGGAAAAGGCGTTAAGCAG
AV2 GGTCTCTTTGGAGGGAGCTG
AV3 CAGCCAGAAGCTGAGGTC
AV4 AGTGACCGTGCTCCTGAC
AV8.1 TGATGCTTGAGATGCTCCTG
AV8.2 CGGTCACATCAACGTCTCTG
AV8.3 ATTCCAGAGGCCAGTCAGTG
AV9 CTTCTCCAGGCTTAGTGACTG
AV10 TGAGTGGCAAAAACCAAGTG
AV12 CACAGTGGAGCAGAGTCCTG
AV5 and 13 CTTGTGGCT(A/G)CAGCTGGAC
AV14 AGGTGGTCGTGGCTTCACT
AV16 CAAGAGCCCAGACAGTGACTC
AV17 GAGAAGCTTCTGGCCCTG
AV18 GTTGTTACCCT(C/T)CCCGAGAAG
AV19 G(G/C)ATGTA(A/G)CCTTGAACTGTGC
AV20 CCAGGAGGGGGACAGTCT
AV21 GCCTGCTCATCCTTTGGTTA
AV22 CTT(C/T)TGTTTGCCCAGGTTTG
AV23 AAGTGACCAA(G/C)AGCAGGTGA
AV24 CCCTTGCTGTGGGTTCAG
AV25 G(G/C)ACCAGTGTTGATCTTA(C/T)GGA
AV26 TCCATGGATT(A/G)T(G/C)CTGAAGG
AV27 TGGTCTTTTGGATTCAACTGG
AV28 ACAAAGAAGAGTCTTGCTGAGTC
AV29 GCTTCAGTCTGACTGGGTG
AV33 GGCTGACAAAGTTACTGAAGC
AV35 GACATGTGTGAGTGCCCAAC
AV36 CCCCATCTCTGATTGTCCAT
AV38 CACAGTGACCCTGGACTGTA
AV41 AGGAAGGAGACCTCGTCACA
AVX GGCTCTC(A/C)TGACCCTGAACT
AVY GGTGGAGCAGA(A/G)TCCTTCAG
DV1.1 (G/C/T)C(A/T)GCTCTGGGTG(C/T)TCCT
DV1.2 GTGGCCCAGA(A/G)(A/C/T)GTTACTCA
DV2 TCATCCACCTCACCCTCTTC
DVY CGTAACTGGAGGGAACTGGA
DV3 ATGTTTCTCCCTGTGGGCTTC
DVb3 TCTGCCTTGGTTCCAACAAT
  1. All of these primers were designed as part of this study based on sequences of functional members of the TRAV/TRDV subgroups identified in the UMD3.1 genome assembly, with the exception of DV3 which was published previously [17].