Skip to main content

Table 2 Ascertaining possible functional roles for k-mers.

From: Reference-free inference of tumor phylogenies from single-cell sequencing data

Examples of 25-mers that align to the ERBB2 gene Location on ERBB2 gene (bp)
TCACCCAGGTTGGAGTGCAGTGGCA 9592-9616
CACACCTGTAACCCCAGCACTTTGG 16172-16196
CACTCTAGCCTGGGCGACAGAGCGA 36185-36161
  1. Column 1 lists 3 25-mers that aligned to the ERBB2 gene with a single-base difference in DNA sequence. ERBB2 is one of the most frequently amplified genes in primary breast cancer and a widely recognized tumor progression marker.