Table 2 Structural features of CRISPR loci predicted in C. urealyticum strains DSM 7109 and DSM 7111.
Strain | No. of CRISPR loci | No. of cas genes | locus_tag casgenes | No. of spacers | CRISPR size | *CRISPR consensus sequence |
|---|---|---|---|---|---|---|
Corynebacterium urealyticum DSM 7109 | 1 | 7 | cur_1967 cur_1968 cur_1969 cur_1970 cur_1971 cur_1972 cur_1973 | 69 | 28 bp | GGCTCATCCCCGCTGGCGCGGGGAGCAC |
Corynebacterium urealyticum DSM 7111 | 1 | 7 | CU7111_1887 CU7111_1888 CU7111_1889 CU7111_1890 CU7111_1891 CU7111_1892 CU7111_1893 | 69 | 28 bp | GGCTCATCCCCGCTGGCGCGGGGAGCAC |