Skip to main content

Table I Sequence of oligonucleotides used in the study.

From: High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification

Oligonucleotide Sequence
OCP-1822inC 5'GAAGAACTGGACAGATTTACTACGTGACTCGTCATGTCTCAGCTCTAGTA
  CGCTGATCTTAGTGTCAGGATACGGAGATGTTCTGCTTTGTC
OCP-1822ocT 5'GAAGAACTGGACAGATTTACTACGTATGTTGACTGGTCACACGTCGTTCT
  AGTACGCTTCTACTCCCTCTTGAGATGTTCTGCTTTGTT
P1-1822inC- 5'FAM-TCGATGACTGACGGTCATCG(DABCYL-dT)ACTAGAGCTGAGACA
FAM TGACGAGTC
P1-1822ocT- 5'TET-TCGATGACTGACGGTCATCG(DABCYL-dT)ACGACGTGTGACCAG
TET TCAACAT
P2-1822inC 5'aba-aba-GATACGGAGATGTTCTGCTTTGTC
P2-1822ocT 5'aba-aba-CCTCTTGAGATGTTCTGCTTTGTT
OCP-1822C 5'GAAGAACTGGACAGATTTACTACGTATTCTGACTCGTCATGTCTCAGCTT
  TAGTTTAATACGACTCACATATCCCAGATGTTCTGCTTTGTC
OCP-1822T 5'GAAGAACTGGACAGATTTACTACGTATTCTGACTCGTCATGTCTCAGCTT
  TAGTTTAATACGACTCACTATAGGGAGATGTTCTGCTTTGTT
P2-1822C- 5'TET-TCGATGACTGACGGTCATCG(DABCYL-dT)ATATCCCAGATGTTC
TET TGCTTTGTC
P2-1822T- 5'FAM-TCGATGACTGACGGTCATCG(DABCYL-dT)TATAGGGAGATGTTC
FAM TGCTTTGTT
P1 5'aba-aba-CTAAAGCTGAGACATGACGAGTC
  Oligonucleotides used in the studies of ligation
  kinetics, affect of OCP 3' arm length, and ligation
  temperature
CFTR M1101K 5'CTTGTACCTGTCAACACTGCGCTGGTTCCAAAXGAGAATAGAAATGATTT
target T TGTCATCTT
  x = T in wild type and A in mutant
OCP-M1101K23 5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTA
  GTTTAATACGACTCACTATAGGGGACAAAAATCATTTCTATTCTCY
OCP-M1101K20 5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTA
  GTTTAATACGACTCACTATAGGGAAAAATCATTTCTATTCTCY
OCP-M1101K15 5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTA
  GTTTAATACGACTCACTATAGGGTCATTTCTATTCTCY
OCP-M1101K23  
  5'TTTGGAACCAGCGCAGTGTTGACACTCTGACTCGTCATGTCTCAGCTTTAG
  TTTAATACGACTCACTATAGGGTTTCTATTCTCY
  Y = A in wild type and T in mutant. The number 12,
  15, 20 or 23 refers to the number of base pairs the
  3' end forms with the target.