Skip to main content

Table 1

From: Genomic organization of Tropomodulins 2 and 4 and unusual intergenic and intraexonic splicing of YL-1 and Tropomodulin 4

  TMOD2  
Exon 5' intron (5'-3) Exon (bp) 3' intron (5'-3') Intron (kb)
E0 5' UTR 69 GTGAGCGCCCCGGGGGGCGGGTGG 14.6
1 TATTGTGTTTCTTTTTTATTAACAG 195 GTTAGTGACATGGAACTGAAGCAGA 1.7
2 CCTGCTCACACCTCTTTCTTGTCAG 157 GTAAGGACCACAGGCAGAGCATCTT 5
3 TTTTTGTTTTTCTTCTGATTTAAAG 123 GTTAGTCCTGAACTCTGGGAACTTT 3
4 ATGCTCATTTGTTGACTGTTTTTAG 87 GTAAGTTGATGTGCAATCTGTGGTT 3.6
5 TTTAAAATGAAAACTTGTGTTTTAG 131 GTATTTCATTGTGATTATCATCAGT 1.6
6 ACTAGCCATGTCCTCTCTGTCTTAG 108 GTGAGTAAAATTCTTAGAAATATAA 17
7 GTTTTTTTTCTTTTTGCATCATAAG 144 GTAAGGAAGGCCAGAGAATAGGCAA 8
8 TGCATGTGTCTGCACCTGCAACCAG 145 GTAATTCAGCCATAATATTTGCTGT 2
9 TTTTGTTCCTTTCTTTCTTACCTAG 1314 3' UTR  
  TMOD4  
Exon 5' intron (5'-3') Exon (bp) 3' intron (5'-3') Intron (bp)
E0 5' UTR 93 GTAGGTGGGGAAGACAGGGGGCTTA 1006
1 CATCCTTTTGTCCCATGTTGCCCAG 165 GTAGGGGCTCCAGCACAGGGAACCA 205
2 TTGCTCCCCAAAACTCATCCCTAAG 157 GTATGGGGACCCTGACATCCATGCC 775
3 GAGCCATCCTTCATCTCCCCATCAG 117 GTGGGTAGCTGTGGGAAGTTGAGGG 952
4 TGACTCCTCTTCTTACCCTCTCCAG 90 GTGAGTGTGTTTGGGGAGCATGGTC 506
5 TTCCCTTCCTGCCCTCATTCACCAG 131 GTATTTGACTTGCATCCTCCAAACC 92
6 ACCATCTCCTATTCCCCTCCGATAG 108 GTAAGGCTAGTTGACATCCCCAGCC 368
7 CCTAACCCAAGTCCCTACTACCCAG 144 GTCAGCATTCCCTTCCCCTGATGTT 256
8 CAGCTTTTGCCTCTCCCTCCCCCAG 145 GTGAGTAACTGCAGACATGATGTGT 415
9 TATGTTTAATATTGCTCCTTTACAG 108 3' UTR  
  YL-1  
Exon 5' intron (5'-3') Exon (bp) 3' intron (5'-3') Intron (kb)
1 5' UTR 122 GCAAGATCCGGGCCTGGGAAAAGGG 4.5
2 AACCCTTATCTCCCTGTGTCCTTAG 153 GTACAGGGGGAGTCCTAGTTGTCTT 0.178
3 GTATCTGATTCCAATCTGTCCTCAG 115 GTGAGTAGGGATGTTAGGGTCAATT 1
4 TTCTTCTTATCTCACTCTCTTCCAG 177 GTAAGTCTGTGGTTTCAGAAAAAGT 6
5 CTCATTTCTTCCTTTGACCCTAAAG 145 GTGAGTGAATCTCAAGAGGAAAAGA 1.2
6 GTTTTTCCTTGTCTTTTGTCCTCAG 724 3' UTR