Skip to main content

Table 2

From: Genomic organization of Tropomodulins 2 and 4 and unusual intergenic and intraexonic splicing of YL-1 and Tropomodulin 4

   TMOD2  
  Anneal    
Exon (° C) Forward Primer (5'-3') Reverse Primer (5'-3') Product size (bp)
1 54 TTCAATACAGTAGGCTCCA CGAGCTAAGGGATTTCTAC 393
2 55 GGTATCCTTCCTGCTTCC GGCTTATTTCCCATGTCT 413
3 54 TCTGCTCAGTCTACTTACCC CCATAATGCCTTGTGTCA 322
4 54 TTCAAGGGACAAATTAACA AAAGCCCAAGTGATCCTA 289
5 54 AGTGTTATTGGAATCAGCAT CTCCAACTCAGTGACTACAAA 358
   *GTAAAACGACGGCCAGTTGCTGAAGGCTA **GGAAACAGCTATGACCATGACTATAAT  
6 57 GGTAATGA TTTGCTCACTAACTGT 390
7 54 TTAATTTGGGAGTGAGGG ACAGGAAATCCAGTACATCA 356
8 54 CCTGTGCAAGTAACTGTTTC AGTGACATCAGAGGCCAG 323
9 54 ATGTTGTTTATCTGGAATTTA CCCATGAGCAAATAAAAC 307
   *indicates a M13 universal sequence attached **indicates a M13 reverse sequence  
   at 5' end attached at 5' end